Regulon of GalR in Pseudoalteromonas haloplanktis TAC125

Properties
Regulator type:	Transcription factor
TF locus tag:	PSHAa1771
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 6.3 Sequence: AAGGGTAAACGCTTACCCCG Locus tag: PSHAa1771 Name: galR Funciton: Transcriptional regulator for galactose utilization, LacI family
	PSHAa1771	galR	Transcriptional regulator for galactose utilization, LacI family
Position: -54 Score: 6.3 Sequence: CGGGGTAAGCGTTTACCCTT Locus tag: PSHAa1770 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) Locus tag: PSHAa1769 Name: galK Funciton: Galactokinase (EC 2.7.1.6) Locus tag: PSHAa1768 Name: galP Funciton: Predicted sodium-dependent galactose transporter Locus tag: PSHAa1767 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	PSHAa1770	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
	PSHAa1769	galK	Galactokinase (EC 2.7.1.6)
	PSHAa1768	galP	Predicted sodium-dependent galactose transporter
	PSHAa1767	galM	Aldose 1-epimerase (EC 5.1.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD