Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing omp_Gal gene

Properties
Regulog: GalR - Alteromonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alteromonas macleodii 'Deep ecotype'
Position: -140
Score: 6.06778
Sequence: TATGGTAAACGTTTACCCAA
Locus tag: MADE_00241
Name: omp_Gal
Funciton: Predicted galactose-specific outer membrane transporter, TonB-dependent
Locus tag: MADE_00239
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
omp_Gal-lacZ -140 6.1 TATGGTAAACGTTTACCCAA MADE_00241