Regulog SMb21598 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 7 | 2 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | 3 | 2 |
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 7 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 7 | 2 |
| Rhizobium sp. NGR234 | 7 | 2 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 7 | 2 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| COG0673 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -62 score = 6.4207 sequence = TCTCGTAAACGTTTACGACG Gene: Atu4363: Predicted dehydrogenases and related proteins |
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -88 score = 6.49503 sequence = TCTCGTAAACGTTTACGGAA Gene: mll1511: Predicted dehydrogenases and related proteins |
|
|
*
Rhizobium etli CFN 42 Site: position = -99 score = 6.36396 sequence = AGTCGTAAACGTTTACGGAG Gene: RHE_PB00117: Predicted dehydrogenases and related proteins |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -64 score = 6.36396 sequence = AGTCGTAAACGTTTACGGAG Gene: pRL90239: Predicted dehydrogenases and related proteins |
*
Rhizobium sp. NGR234 Site: position = -98 score = 6.4383 sequence = TTCCGTAAACGTTTACGGAC Gene: NGR_b15590: Predicted dehydrogenases and related proteins |
|
*
Sinorhizobium meliloti 1021 Site: position = -58 score = 6.60754 sequence = TTCCGTAAACGTTTACGGTG Gene: SMb21597: Predicted dehydrogenases and related proteins |
|
Predicted dehydrogenases and related proteins |
| COG1082 |
Gene: Atu4362: Sugar phosphate isomerases/epimerases |
|
|
|
|
|
Gene: mll1509: Sugar phosphate isomerases/epimerases |
|
|
Gene: RHE_PB00116: Sugar phosphate isomerases/epimerases |
Gene: pRL90238: Sugar phosphate isomerases/epimerases |
Gene: NGR_b15580: Sugar phosphate isomerases/epimerases |
|
Gene: SMb21596: Sugar phosphate isomerases/epimerases |
|
Sugar phosphate isomerases/epimerases |
| SMb21595 |
Gene: Atu4361: Sugar ABC transporter, periplasmic sugar-binding protein |
|
|
|
|
|
|
|
|
Gene: RHE_PB00115: Sugar ABC transporter, periplasmic sugar-binding protein |
Gene: pRL90237: Sugar ABC transporter, periplasmic sugar-binding protein |
Gene: NGR_b15570: Sugar ABC transporter, periplasmic sugar-binding protein |
|
Gene: SMb21595: Sugar ABC transporter, periplasmic sugar-binding protein |
|
Sugar ABC transporter, periplasmic sugar-binding protein |
| SMb21594 |
Gene: Atu4360: Sugar ABC transporter, membrane spanning protein |
|
|
|
|
|
|
|
|
Gene: RHE_PB00114: Sugar ABC transporter, membrane spanning protein |
Gene: pRL90235: Sugar ABC transporter, membrane spanning protein |
Gene: NGR_b15560: Sugar ABC transporter, membrane spanning protein |
|
Gene: SMb21594: Sugar ABC transporter, membrane spanning protein |
|
Sugar ABC transporter, membrane spanning protein |
| SMb21593 |
Gene: Atu4359: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
Gene: RHE_PB00113: Sugar ABC transporter, inner membrane protein |
Gene: pRL90234: Sugar ABC transporter, inner membrane protein |
Gene: NGR_b15550: Sugar ABC transporter, inner membrane protein |
|
Gene: SMb21593: Sugar ABC transporter, inner membrane protein |
|
Sugar ABC transporter, inner membrane protein |
| SMb21592 |
Gene: Atu4358: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
Gene: RHE_PB00112: Sugar ABC transporter, ATP-binding protein |
Gene: pRL90233: Sugar ABC transporter, ATP-binding protein |
Gene: NGR_b15540: Sugar ABC transporter, ATP-binding protein |
|
Gene: SMb21592: Sugar ABC transporter, ATP-binding protein |
|
Sugar ABC transporter, ATP-binding protein |
| CRON 2. | ||||||||||||||||
| SMb21598 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -96 score = 6.57232 sequence = CGTCGTAAACGTTTACGAGA Gene: Atu4364: Transcriptional regulator for sugar utilization, LacI family |
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -121 score = 6.77499 sequence = TTCCGTAAACGTTTACGAGA Site: position = -134 score = 5.44673 sequence = CGCCGTAAACGTTTTCCGTA Gene: mlr1512: Transcriptional regulator for sugar utilization, LacI family |
|
|
*
Rhizobium etli CFN 42 Site: position = -91 score = 6.65798 sequence = CTCCGTAAACGTTTACGACT Gene: RHE_PB00118: Transcriptional regulator for sugar utilization, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -171 score = 6.65798 sequence = CTCCGTAAACGTTTACGACT Gene: pRL90240: Transcriptional regulator for sugar utilization, LacI family |
*
Rhizobium sp. NGR234 Site: position = -63 score = 6.7696 sequence = GTCCGTAAACGTTTACGGAA Gene: NGR_b15600: Transcriptional regulator for sugar utilization, LacI family |
|
*
Sinorhizobium meliloti 1021 Site: position = -195 score = 6.70363 sequence = CACCGTAAACGTTTACGGAA Gene: SMb21598: Transcriptional regulator for sugar utilization, LacI family |
|
Transcriptional regulator for sugar utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |