Regulon of SMb21598 in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mlr1512
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21598 - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -134 Score: 5.4 Sequence: CGCCGTAAACGTTTTCCGTA Position: -121 Score: 6.8 Sequence: TTCCGTAAACGTTTACGAGA Locus tag: mlr1512 Name: SMb21598 Funciton: Transcriptional regulator for sugar utilization, LacI family
	mlr1512	SMb21598	Transcriptional regulator for sugar utilization, LacI family
Position: -88 Score: 6.5 Sequence: TCTCGTAAACGTTTACGGAA Locus tag: mll1511 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: mll1509 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
	mll1511	COG0673	Predicted dehydrogenases and related proteins
	mll1509	COG1082	Sugar phosphate isomerases/epimerases

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD