Regulon of SMb21598 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b15600
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21598 - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 6.4 Sequence: TTCCGTAAACGTTTACGGAC Locus tag: NGR_b15590 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: NGR_b15580 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: NGR_b15570 Name: SMb21595 Funciton: Sugar ABC transporter, periplasmic sugar-binding protein Locus tag: NGR_b15560 Name: SMb21594 Funciton: Sugar ABC transporter, membrane spanning protein Locus tag: NGR_b15550 Name: SMb21593 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: NGR_b15540 Name: SMb21592 Funciton: Sugar ABC transporter, ATP-binding protein
	NGR_b15590	COG0673	Predicted dehydrogenases and related proteins
	NGR_b15580	COG1082	Sugar phosphate isomerases/epimerases
	NGR_b15570	SMb21595	Sugar ABC transporter, periplasmic sugar-binding protein
	NGR_b15560	SMb21594	Sugar ABC transporter, membrane spanning protein
	NGR_b15550	SMb21593	Sugar ABC transporter, inner membrane protein
	NGR_b15540	SMb21592	Sugar ABC transporter, ATP-binding protein
Position: -63 Score: 6.8 Sequence: GTCCGTAAACGTTTACGGAA Locus tag: NGR_b15600 Name: SMb21598 Funciton: Transcriptional regulator for sugar utilization, LacI family
	NGR_b15600	SMb21598	Transcriptional regulator for sugar utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD