Regulon of SMb21598 in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb21598
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21598 - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -195 Score: 6.7 Sequence: CACCGTAAACGTTTACGGAA Locus tag: SMb21598 Name: SMb21598 Funciton: Transcriptional regulator for sugar utilization, LacI family
	SMb21598	SMb21598	Transcriptional regulator for sugar utilization, LacI family
Position: -58 Score: 6.6 Sequence: TTCCGTAAACGTTTACGGTG Locus tag: SMb21597 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: SMb21596 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: SMb21595 Name: SMb21595 Funciton: Sugar ABC transporter, periplasmic sugar-binding protein Locus tag: SMb21594 Name: SMb21594 Funciton: Sugar ABC transporter, membrane spanning protein Locus tag: SMb21593 Name: SMb21593 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMb21592 Name: SMb21592 Funciton: Sugar ABC transporter, ATP-binding protein
	SMb21597	COG0673	Predicted dehydrogenases and related proteins
	SMb21596	COG1082	Sugar phosphate isomerases/epimerases
	SMb21595	SMb21595	Sugar ABC transporter, periplasmic sugar-binding protein
	SMb21594	SMb21594	Sugar ABC transporter, membrane spanning protein
	SMb21593	SMb21593	Sugar ABC transporter, inner membrane protein
	SMb21592	SMb21592	Sugar ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD