Regulog CadR-PbrR - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | 1 | 1 |
| Paracoccus denitrificans PD1222 | 2 | 2 |
| Jannaschia sp. CCS1 | ||
| Rhodobacterales bacterium HTCC2654 | 8 | 5 |
| Oceanicola granulosus HTCC2516 | 1 | 1 |
| Loktanella vestfoldensis SKA53 | ||
| Oceanicola batsensis HTCC2597 | 13 | 6 |
| Roseovarius nubinhibens ISM | 6 | 4 |
| Roseovarius sp. 217 | 6 | 5 |
| Sulfitobacter sp. EE-36 | 3 | 1 |
| Silicibacter TM1040 | 1 | 1 |
| Silicibacter pomeroyi DSS-3 | ||
| Roseobacter sp. MED193 | 9 | 5 |
| Hyphomonas neptunium ATCC 15444 | 2 | 1 |
| Oceanicaulis alexandrii HTCC2633 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| PF01841 |
|
|
|
*
Rhodobacterales bacterium HTCC2654 Site: position = -78 score = 5.12465 sequence = AAGCTACAGTGACTGTAGCAA Gene: RB2654_22408: Transglutaminase-like protein |
|
|
*
Oceanicola batsensis HTCC2597 Site: position = -57 score = 5.12465 sequence = AAGCTACAGTGACTGTAGCAA Gene: OB2597_16652: Transglutaminase-like protein |
*
Roseovarius nubinhibens ISM Site: position = -64 score = 5.59608 sequence = AAGCTATAGTGACTATAGCAA Gene: ISM_17525: Transglutaminase-like protein |
|
|
|
|
*
Roseobacter sp. MED193 Site: position = -57 score = 4.87793 sequence = AAGCTACAGTAACTATAGAGA Gene: MED193_02255: Transglutaminase-like protein |
|
|
Transglutaminase-like protein |
| czcD2 |
|
|
|
*2
Rhodobacterales bacterium HTCC2654 Gene: RB2654_22413: Co/Zn/Cd efflux protein Site: position = -50 score = 6.27327 sequence = AACCTCTAGTCGCTAGAGGAA Gene: RB2654_10329: Co/Zn/Cd efflux protein |
|
|
Gene: OB2597_16657: Co/Zn/Cd efflux protein |
Gene: ISM_17520: Co/Zn/Cd efflux protein |
|
|
|
|
Gene: MED193_02260: Co/Zn/Cd efflux protein |
|
|
Co/Zn/Cd efflux protein |
| PF11964 |
|
|
|
Gene: RB2654_22418: hypothetical protein |
|
|
Gene: OB2597_16662: hypothetical protein |
|
|
|
|
|
|
|
|
hypothetical protein |
| CRON 2. | ||||||||||||||||
| cadR |
|
|
|
*
Rhodobacterales bacterium HTCC2654 Site: position = -119 score = 5.72403 sequence = ATCCTCTAGCTACTGTAGGTT Gene: RB2654_22398: Cadmium resistance transcriptional regulator, MerR family |
|
|
*
Oceanicola batsensis HTCC2597 Site: position = -134 score = 5.72403 sequence = ATCCTCTAGCTACTGTAGGTT Gene: OB2597_16642: Cadmium resistance transcriptional regulator, MerR family |
*
Roseovarius nubinhibens ISM Site: position = -129 score = 6.01198 sequence = ATCCTCTAGCAGCTAGAGGTT Gene: ISM_17535: Cadmium resistance transcriptional regulator, MerR family |
*
Roseovarius sp. 217 Site: position = -135 score = 5.72403 sequence = ATCCTCTAGCTACTGTAGGTT Gene: ROS217_02950: Cadmium resistance transcriptional regulator, MerR family |
|
|
|
*
Roseobacter sp. MED193 Site: position = -117 score = 6.19546 sequence = ATCCTCTAGCTACTAGAGGTT Gene: MED193_02240: Cadmium resistance transcriptional regulator, MerR family |
|
|
Cadmium resistance transcriptional regulator, MerR family |
| PF02694 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: MED193_02245: Protein of unknown function UPF0060 |
|
|
Protein of unknown function UPF0060 |
| czcD |
|
|
|
Gene: RB2654_22403: Co/Zn/Cd efflux protein |
|
|
2
Oceanicola batsensis HTCC2597 Gene: OB2597_16707: Co/Zn/Cd efflux protein Gene: OB2597_16647: Co/Zn/Cd efflux protein |
Gene: ISM_17530: Co/Zn/Cd efflux protein |
*2
Roseovarius sp. 217 Site: position = -128 score = 5.80329 sequence = AAGCTCTAGTCACTAGAGAGA Gene: ROS217_13921: Co/Zn/Cd efflux protein Gene: ROS217_02945: Co/Zn/Cd efflux protein |
|
*
Silicibacter TM1040 Site: position = -71 score = 6.26213 sequence = AACCTCTAGTCACTAGAGCAA Gene: TM1040_2930: Co/Zn/Cd efflux protein |
|
Gene: MED193_02250: Co/Zn/Cd efflux protein |
*
Hyphomonas neptunium ATCC 15444 Site: position = -53 score = 5.88338 sequence = ATCCTCTAGTTACTTGAGGAT Gene: HNE_1727: Co/Zn/Cd efflux protein |
|
Co/Zn/Cd efflux protein |
| lspA |
|
|
|
|
|
|
Gene: OB2597_16702: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
Gene: HNE_1728: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| CRON 3. | ||||||||||||||||
| cadR2 |
|
|
|
|
|
|
*
Oceanicola batsensis HTCC2597 Site: position = -124 score = 5.08982 sequence = AAGCTACAGTGGGTAGAGGTT Gene: OB2597_05245: Cadmium resistance transcriptional regulator, MerR family |
|
|
|
|
|
|
|
|
Cadmium resistance transcriptional regulator, MerR family |
| PF02694 |
|
|
|
|
|
|
Gene: OB2597_05250: Protein of unknown function UPF0060 |
|
|
|
|
|
|
|
|
Protein of unknown function UPF0060 |
| PF01841 |
|
|
|
|
|
|
*
Oceanicola batsensis HTCC2597 Site: position = -45 score = 4.94116 sequence = AAGCTACAGTCGCTGTAGCAA Gene: OB2597_05255: Transglutaminase-like protein |
|
|
|
|
|
|
|
|
Transglutaminase-like protein |
| czcD3 |
|
|
|
|
|
|
Gene: OB2597_05260: Co/Zn/Cd efflux protein |
|
|
|
|
|
|
|
|
Co/Zn/Cd efflux protein |
| CRON 4. | ||||||||||||||||
| EE36_00940 |
|
|
|
|
|
|
|
|
|
*
Sulfitobacter sp. EE-36 Site: position = -61 score = 4.81219 sequence = AAGCTACAGTTGCTGTAGGTC Gene: EE36_00940: cation-transporting P-type ATPase |
|
|
|
|
|
cation-transporting P-type ATPase |
| cadA |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -70 score = 5.13063 sequence = AACCTATAGTTGCTAGAGACA Gene: RSP_1791: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*2
Paracoccus denitrificans PD1222 Site: position = -37 score = 5.75504 sequence = AACCTCTAGTTGCTAGAGATC Gene: Pden_0212: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -75 score = 6.07865 sequence = AAGCTCTAGTCGCTAGAGGAA Gene: Pden_2344: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
*
Rhodobacterales bacterium HTCC2654 Site: position = -228 score = 5.34119 sequence = AAGCTCTAGTTACTGTAGGGG Gene: RB2654_22328: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Oceanicola granulosus HTCC2516 Site: position = -63 score = 5.10322 sequence = AACCTACAGTCGGTAGAGGTC Gene: OG2516_17805: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
*2
Oceanicola batsensis HTCC2597 Site: position = -228 score = 5.34119 sequence = AAGCTCTAGTTACTGTAGGGG Gene: OB2597_16572: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -62 score = 5.00681 sequence = AACCTACAGTTGCTGTAGGTC Gene: OB2597_05215: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Roseovarius nubinhibens ISM Site: position = -201 score = 5.1577 sequence = AAGCTCTAGCTACTGTAGGGG Gene: ISM_17615: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Roseovarius sp. 217 Site: position = -271 score = 5.34119 sequence = AAGCTCTAGTTACTGTAGGGG Gene: ROS217_03080: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Gene: EE36_00945: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
*2
Roseobacter sp. MED193 Site: position = -60 score = 5.1577 sequence = AAGCTCTAGCTACTGTAGGGG Gene: MED193_02180: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -58 score = 5.87994 sequence = AACCTCTAGTCACTGTAGGTC Gene: MED193_15017: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| copG |
|
|
|
|
|
|
Gene: OB2597_05210: Predicted metal binding protein |
|
|
Gene: EE36_00950: Predicted metal binding protein |
|
|
|
|
|
Predicted metal binding protein |
| cadR2 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: MED193_15022: Cadmium resistance transcriptional regulator, MerR family |
|
|
Cadmium resistance transcriptional regulator, MerR family |
| CRON 5. | ||||||||||||||||
| PF03734 |
|
|
|
*
Rhodobacterales bacterium HTCC2654 Site: position = -150 score = 5.29212 sequence = AACCTCTAGTAGCTTTAGGAG Gene: RB2654_22323: hypothetical protein |
|
|
*
Oceanicola batsensis HTCC2597 Site: position = -150 score = 5.29212 sequence = AACCTCTAGTAGCTTTAGGAG Gene: OB2597_16567: hypothetical protein |
*
Roseovarius nubinhibens ISM Site: position = -152 score = 5.57465 sequence = AACCTCTAGCCACTAGAAGTC Gene: ISM_17625: hypothetical protein |
*3
Roseovarius sp. 217 Site: position = -111 score = 5.34303 sequence = AAGCTCTAGTTGGTAGAGGTT Gene: ROS217_02920: hypothetical protein Gene: ROS217_03090: hypothetical protein Site: position = -60 score = 5.14431 sequence = AAGCTCTAGTGGGTGGAGGTC Gene: ROS217_02925: hypothetical protein |
|
|
|
*
Roseobacter sp. MED193 Site: position = -88 score = 5.57465 sequence = AACCTCTAGCCACTAGAAGTC Gene: MED193_02170: hypothetical protein |
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |