Regulon of CadR-PbrR in Sulfitobacter sp. EE-36

Properties
Regulator type:	Transcription factor
TF locus tag:	EE36_00815
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Rhodobacterales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 4.8 Sequence: AAGCTACAGTTGCTGTAGGTC Locus tag: EE36_00940 Name: null Funciton: cation-transporting P-type ATPase Locus tag: EE36_00945 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Locus tag: EE36_00950 Name: copG Funciton: Predicted metal binding protein
	EE36_00940		cation-transporting P-type ATPase
	EE36_00945	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	EE36_00950	copG	Predicted metal binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD