Regulog CadR-PbrR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 1 | 1 |
| Pseudomonas entomophila L48 | 3 | 2 |
| Pseudomonas putida KT2440 | 3 | 2 |
| Pseudomonas syringae pv. tomato str. DC3000 | 1 | 1 |
| Pseudomonas fluorescens Pf-5 | 2 | 1 |
| Pseudomonas mendocina ymp | 3 | 2 |
| Pseudomonas stutzeri A1501 | 3 | 3 |
| Azotobacter vinelandii AvOP | 2 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| czcR |
Gene: PA2523: DNA-binding heavy metal response regulator |
*
Pseudomonas entomophila L48 Site: position = -57 score = 5.14027 sequence = ACCCTGATACAGCTACAGGGT Gene: PSEEN4285: DNA-binding heavy metal response regulator |
*2
Pseudomonas putida KT2440 Site: position = -56 score = 5.8445 sequence = ACCCTGATGTCACTACAGGGT Gene: PP1438: DNA-binding heavy metal response regulator Gene: PP0029: DNA-binding heavy metal response regulator |
Gene: PSPTO0378: DNA-binding heavy metal response regulator |
*
Pseudomonas fluorescens Pf-5 Site: position = -71 score = 5.78683 sequence = ACCCTATAGCTACTACAGACT Gene: PFL_3147: DNA-binding heavy metal response regulator |
*
Pseudomonas mendocina ymp Site: position = -115 score = 6.29557 sequence = ACCCTGTAGTAACTACAGGGA Gene: Pmen_1174: DNA-binding heavy metal response regulator |
|
|
DNA-binding heavy metal response regulator |
| PF00512 |
Gene: PA2524: Heavy metal sensor histidine kinase |
Gene: PSEEN4286: Heavy metal sensor histidine kinase |
2
Pseudomonas putida KT2440 Gene: PP1437: Heavy metal sensor histidine kinase Gene: PP0030: Heavy metal sensor histidine kinase |
Gene: PSPTO0379: Heavy metal sensor histidine kinase |
Gene: PFL_3148: Heavy metal sensor histidine kinase |
Gene: Pmen_1173: Heavy metal sensor histidine kinase |
|
|
Heavy metal sensor histidine kinase |
| CRON 2. | |||||||||
| cadA |
*
Pseudomonas aeruginosa PAO1 Site: position = -60 score = 6.43039 sequence = ACTCTGTAGTTGCTACAGGGT Gene: PA3690: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Pseudomonas entomophila L48 Site: position = -163 score = 6.49822 sequence = ACCCTATAGTGGCTACAGGGT Gene: PSEEN5232: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Pseudomonas putida KT2440 Site: position = -58 score = 6.49822 sequence = ACCCTATAGTGGCTACAGGGT Gene: PP5139: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -59 score = 6.49822 sequence = ACCCTATAGTGGCTACAGGGT Gene: PSPTO5279: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Gene: PFL_5892: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Pseudomonas mendocina ymp Site: position = -57 score = 6.64247 sequence = ACCCTATAGTGACTACAGGGT Gene: Pmen_4225: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Pseudomonas stutzeri A1501 Site: position = -210 score = 6.21907 sequence = ACCCTGTAGTGGCTTTAGGGT Gene: PST_0664: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Azotobacter vinelandii AvOP Site: position = -114 score = 6.25511 sequence = ACTCTGTAGTGGCTACAGAGT Gene: Avin_18520: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| CRON 3. | |||||||||
| czcD2 |
|
|
|
|
|
|
*
Pseudomonas stutzeri A1501 Site: position = -61 score = 5.94471 sequence = ACCTTGTAGTAGCTATAGGGC Gene: PST_3416: Co/Zn/Cd efflux protein |
|
Co/Zn/Cd efflux protein |
| CRON 4. | |||||||||
| czcD |
|
|
|
|
|
|
*
Pseudomonas stutzeri A1501 Site: position = -57 score = 6.58312 sequence = ACCCTGTAGTTGCTACAGGGT Gene: PST_1619: Co/Zn/Cd efflux protein |
*
Azotobacter vinelandii AvOP Site: position = -58 score = 6.13719 sequence = ACCCTGAAGCCGCTACAGGGT Gene: Avin_24510: Co/Zn/Cd efflux protein |
Co/Zn/Cd efflux protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |