Regulog CadR-PbrR - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Statistics of regulated genes
Genome	Genes	Operons
Pseudomonas aeruginosa PAO1	1	1
Pseudomonas entomophila L48	3	2
Pseudomonas putida KT2440	3	2
Pseudomonas syringae pv. tomato str. DC3000	1	1
Pseudomonas fluorescens Pf-5	2	1
Pseudomonas mendocina ymp	3	2
Pseudomonas stutzeri A1501	3	3
Azotobacter vinelandii AvOP	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
czcR	Pseudomonas aeruginosa PAO1 Gene: PA2523: DNA-binding heavy metal response regulator	* Pseudomonas entomophila L48 Site: position = -57 score = 5.14027 sequence = ACCCTGATACAGCTACAGGGT Gene: PSEEN4285: DNA-binding heavy metal response regulator	2 Pseudomonas putida KT2440* Site: position = -56 score = 5.8445 sequence = ACCCTGATGTCACTACAGGGT Gene: PP1438: DNA-binding heavy metal response regulator Gene: PP0029: DNA-binding heavy metal response regulator	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0378: DNA-binding heavy metal response regulator	* Pseudomonas fluorescens Pf-5 Site: position = -71 score = 5.78683 sequence = ACCCTATAGCTACTACAGACT Gene: PFL_3147: DNA-binding heavy metal response regulator	* Pseudomonas mendocina ymp Site: position = -115 score = 6.29557 sequence = ACCCTGTAGTAACTACAGGGA Gene: Pmen_1174: DNA-binding heavy metal response regulator	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	DNA-binding heavy metal response regulator
PF00512	Pseudomonas aeruginosa PAO1 Gene: PA2524: Heavy metal sensor histidine kinase	Pseudomonas entomophila L48 Gene: PSEEN4286: Heavy metal sensor histidine kinase	2 Pseudomonas putida KT2440 Gene: PP1437: Heavy metal sensor histidine kinase Gene: PP0030: Heavy metal sensor histidine kinase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0379: Heavy metal sensor histidine kinase	Pseudomonas fluorescens Pf-5 Gene: PFL_3148: Heavy metal sensor histidine kinase	Pseudomonas mendocina ymp Gene: Pmen_1173: Heavy metal sensor histidine kinase	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Heavy metal sensor histidine kinase

CRON 2.
cadA	* Pseudomonas aeruginosa PAO1 Site: position = -60 score = 6.43039 sequence = ACTCTGTAGTTGCTACAGGGT Gene: PA3690: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	* Pseudomonas entomophila L48 Site: position = -163 score = 6.49822 sequence = ACCCTATAGTGGCTACAGGGT Gene: PSEEN5232: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	* Pseudomonas putida KT2440 Site: position = -58 score = 6.49822 sequence = ACCCTATAGTGGCTACAGGGT Gene: PP5139: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -59 score = 6.49822 sequence = ACCCTATAGTGGCTACAGGGT Gene: PSPTO5279: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	Pseudomonas fluorescens Pf-5 Gene: PFL_5892: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	* Pseudomonas mendocina ymp Site: position = -57 score = 6.64247 sequence = ACCCTATAGTGACTACAGGGT Gene: Pmen_4225: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	* Pseudomonas stutzeri A1501 Site: position = -210 score = 6.21907 sequence = ACCCTGTAGTGGCTTTAGGGT Gene: PST_0664: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	* Azotobacter vinelandii AvOP Site: position = -114 score = 6.25511 sequence = ACTCTGTAGTGGCTACAGAGT Gene: Avin_18520: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

CRON 3.
czcD2	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	* Pseudomonas stutzeri A1501 Site: position = -61 score = 5.94471 sequence = ACCTTGTAGTAGCTATAGGGC Gene: PST_3416: Co/Zn/Cd efflux protein	Azotobacter vinelandii AvOP	Co/Zn/Cd efflux protein

CRON 4.
czcD	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	* Pseudomonas stutzeri A1501 Site: position = -57 score = 6.58312 sequence = ACCCTGTAGTTGCTACAGGGT Gene: PST_1619: Co/Zn/Cd efflux protein	* Azotobacter vinelandii AvOP Site: position = -58 score = 6.13719 sequence = ACCCTGAAGCCGCTACAGGGT Gene: Avin_24510: Co/Zn/Cd efflux protein	Co/Zn/Cd efflux protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CadR-PbrR - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --