Regulon of CadR-PbrR in Pseudomonas entomophila L48

Properties
Regulator type:	Transcription factor
TF locus tag:	PSEEN5233
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 6.5 Sequence: ACCCTATAGTGGCTACAGGGT Locus tag: PSEEN5232 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	PSEEN5232	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Position: -57 Score: 5.1 Sequence: ACCCTGATACAGCTACAGGGT Locus tag: PSEEN4285 Name: czcR Funciton: DNA-binding heavy metal response regulator Locus tag: PSEEN4286 Name: PF00512 Funciton: Heavy metal sensor histidine kinase
	PSEEN4285	czcR	DNA-binding heavy metal response regulator
	PSEEN4286	PF00512	Heavy metal sensor histidine kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD