Regulon of CadR-PbrR in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_5893
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5.8 Sequence: ACCCTATAGCTACTACAGACT Locus tag: PFL_3147 Name: czcR Funciton: DNA-binding heavy metal response regulator Locus tag: PFL_3148 Name: PF00512 Funciton: Heavy metal sensor histidine kinase
	PFL_3147	czcR	DNA-binding heavy metal response regulator
	PFL_3148	PF00512	Heavy metal sensor histidine kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD