Regulon of CadR-PbrR in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP5140
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.5 Sequence: ACCCTATAGTGGCTACAGGGT Locus tag: PP5139 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	PP5139	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Position: -56 Score: 5.8 Sequence: ACCCTGATGTCACTACAGGGT Locus tag: PP1438 Name: czcR Funciton: DNA-binding heavy metal response regulator Locus tag: PP1437 Name: PF00512 Funciton: Heavy metal sensor histidine kinase
	PP1438	czcR	DNA-binding heavy metal response regulator
	PP1437	PF00512	Heavy metal sensor histidine kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD