Regulog CadR-PbrR - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio piger ATCC 29098 | 1 | 1 |
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio magneticus RS-1 | 1 | 1 |
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfohalobium retbaense DSM 5692 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| cadA |
|
|
|
|
*
Desulfovibrio piger ATCC 29098 Site: position = -373 score = 5.42287 sequence = ACCCTATAGCGACTATAGGCC Gene: DESPIG_01843: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
*
Desulfovibrio magneticus RS-1 Site: position = -55 score = 5.88058 sequence = ACCCTGGAGTTGCTCCAAGGT Gene: DMR_12750: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |