Regulog MerR - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia sp. 383 | ||
| Burkholderia cepacia AMMD | ||
| Burkholderia vietnamiensis G4 | ||
| Burkholderia glumae BGR1 | 2 | 1 |
| Burkholderia xenovorans LB400 | 8 | 2 |
| Burkholderia phymatum STM815 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| merT |
|
|
|
|
|
|
*2
Burkholderia xenovorans LB400 Site: position = -57 score = 5.78517 sequence = ACTCCGTACTCAGGTACGCACC Gene: Bxe_A0238: Mercury uptake inner membane protein Site: position = -63 score = 6.1447 sequence = ACTCCGTACATGACTACGGAAG Gene: Bxe_C1216: Mercury uptake inner membane protein |
|
Mercury uptake inner membane protein |
| merP |
|
|
|
|
|
|
2
Burkholderia xenovorans LB400 Gene: Bxe_A0239: Periplasmic mercury (+2) binding protein Gene: Bxe_C1215: Periplasmic mercury (+2) binding protein |
|
Periplasmic mercury (+2) binding protein |
| merC |
|
|
|
|
|
*
Burkholderia glumae BGR1 Site: position = -152 score = 5.98822 sequence = ACTCCGTAGTCGACTACGGAAG Gene: bglu_2p0790: Mercury uptake inner membane protein |
Gene: Bxe_C1214: Mercury uptake inner membane protein |
|
Mercury uptake inner membane protein |
| merA |
|
|
|
|
|
Gene: bglu_2p0780: Mercuric ion reductase (EC 1.16.1.1) |
Gene: Bxe_C1213: Mercuric ion reductase (EC 1.16.1.1) |
|
Mercuric ion reductase (EC 1.16.1.1) |
| merD |
|
|
|
|
|
|
Gene: Bxe_C1212: Mercuric resistance operon coregulator |
|
Mercuric resistance operon coregulator |
| merE |
|
|
|
|
|
|
Gene: Bxe_C1211: Putative mercury resistance protein |
|
Putative mercury resistance protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |