Regulog MerR - Burkholderia

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/Beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Statistics of regulated genes
Genome	Genes	Operons
Burkholderia pseudomallei K96243
Burkholderia mallei ATCC 23344
Burkholderia sp. 383
Burkholderia cepacia AMMD
Burkholderia vietnamiensis G4
Burkholderia glumae BGR1	2	1
Burkholderia xenovorans LB400	8	2
Burkholderia phymatum STM815

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
merT	Burkholderia pseudomallei K96243	Burkholderia mallei ATCC 23344	Burkholderia sp. 383	Burkholderia cepacia AMMD	Burkholderia vietnamiensis G4	Burkholderia glumae BGR1	2 Burkholderia xenovorans LB400* Site: position = -57 score = 5.78517 sequence = ACTCCGTACTCAGGTACGCACC Gene: Bxe_A0238: Mercury uptake inner membane protein Site: position = -63 score = 6.1447 sequence = ACTCCGTACATGACTACGGAAG Gene: Bxe_C1216: Mercury uptake inner membane protein	Burkholderia phymatum STM815	Mercury uptake inner membane protein
merP	Burkholderia pseudomallei K96243	Burkholderia mallei ATCC 23344	Burkholderia sp. 383	Burkholderia cepacia AMMD	Burkholderia vietnamiensis G4	Burkholderia glumae BGR1	2 Burkholderia xenovorans LB400 Gene: Bxe_A0239: Periplasmic mercury (+2) binding protein Gene: Bxe_C1215: Periplasmic mercury (+2) binding protein	Burkholderia phymatum STM815	Periplasmic mercury (+2) binding protein
merC	Burkholderia pseudomallei K96243	Burkholderia mallei ATCC 23344	Burkholderia sp. 383	Burkholderia cepacia AMMD	Burkholderia vietnamiensis G4	* Burkholderia glumae BGR1 Site: position = -152 score = 5.98822 sequence = ACTCCGTAGTCGACTACGGAAG Gene: bglu_2p0790: Mercury uptake inner membane protein	Burkholderia xenovorans LB400 Gene: Bxe_C1214: Mercury uptake inner membane protein	Burkholderia phymatum STM815	Mercury uptake inner membane protein
merA	Burkholderia pseudomallei K96243	Burkholderia mallei ATCC 23344	Burkholderia sp. 383	Burkholderia cepacia AMMD	Burkholderia vietnamiensis G4	Burkholderia glumae BGR1 Gene: bglu_2p0780: Mercuric ion reductase (EC 1.16.1.1)	Burkholderia xenovorans LB400 Gene: Bxe_C1213: Mercuric ion reductase (EC 1.16.1.1)	Burkholderia phymatum STM815	Mercuric ion reductase (EC 1.16.1.1)
merD	Burkholderia pseudomallei K96243	Burkholderia mallei ATCC 23344	Burkholderia sp. 383	Burkholderia cepacia AMMD	Burkholderia vietnamiensis G4	Burkholderia glumae BGR1	Burkholderia xenovorans LB400 Gene: Bxe_C1212: Mercuric resistance operon coregulator	Burkholderia phymatum STM815	Mercuric resistance operon coregulator
merE	Burkholderia pseudomallei K96243	Burkholderia mallei ATCC 23344	Burkholderia sp. 383	Burkholderia cepacia AMMD	Burkholderia vietnamiensis G4	Burkholderia glumae BGR1	Burkholderia xenovorans LB400 Gene: Bxe_C1211: Putative mercury resistance protein	Burkholderia phymatum STM815	Putative mercury resistance protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MerR - Burkholderia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --