Regulon of MerR in Burkholderia xenovorans LB400

Properties
Regulator type:	Transcription factor
TF locus tag:	Bxe_A0237, Bxe_C1217
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Burkholderia
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.1 Sequence: ACTCCGTACATGACTACGGAAG Locus tag: Bxe_C1216 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Bxe_C1215 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: Bxe_C1214 Name: merC Funciton: Mercury uptake inner membane protein Locus tag: Bxe_C1213 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: Bxe_C1212 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: Bxe_C1211 Name: merE Funciton: Putative mercury resistance protein
	Bxe_C1216	merT	Mercury uptake inner membane protein
	Bxe_C1215	merP	Periplasmic mercury (+2) binding protein
	Bxe_C1214	merC	Mercury uptake inner membane protein
	Bxe_C1213	merA	Mercuric ion reductase (EC 1.16.1.1)
	Bxe_C1212	merD	Mercuric resistance operon coregulator
	Bxe_C1211	merE	Putative mercury resistance protein
Position: -57 Score: 5.8 Sequence: ACTCCGTACTCAGGTACGCACC Locus tag: Bxe_A0238 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Bxe_A0239 Name: merP Funciton: Periplasmic mercury (+2) binding protein
	Bxe_A0238	merT	Mercury uptake inner membane protein
	Bxe_A0239	merP	Periplasmic mercury (+2) binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD