Regulon of MerR in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_2p0800
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Burkholderia
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -152 Score: 6 Sequence: ACTCCGTAGTCGACTACGGAAG Locus tag: bglu_2p0790 Name: merC Funciton: Mercury uptake inner membane protein Locus tag: bglu_2p0780 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1)
	bglu_2p0790	merC	Mercury uptake inner membane protein
	bglu_2p0780	merA	Mercuric ion reductase (EC 1.16.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD