Regulog CueR - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756
Caulobacter sp. K31	4	3
Phenylobacterium zucineum HLK1	7	4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
copA	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -56 score = 5.63722 sequence = ACCTTCCCATGATGGGAGGGA Gene: Caul_2317: Copper-translocating P-type ATPase (EC 3.6.3.4)	2 Phenylobacterium zucineum HLK1* Site: position = -59 score = 5.14251 sequence = ACCCTCCCATGGTGGGAAACT Gene: PHZ_c1469: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -59 score = 6.00829 sequence = ACCCTCCCATCATGGGAAGGT Gene: PHZ_p0211: Copper-translocating P-type ATPase (EC 3.6.3.4)	Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	Caulobacter sp. K31 Gene: Caul_2318: Copper-responsive transcriptional regulator, MerR family	2 Phenylobacterium zucineum HLK1 Gene: PHZ_c1468: Copper-responsive transcriptional regulator, MerR family Gene: PHZ_p0210: Copper-responsive transcriptional regulator, MerR family	Copper-responsive transcriptional regulator, MerR family

CRON 2.
copC	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_2515: Copper resistance protein	Caulobacter sp. K31 Gene: Caul_2347: Copper resistance protein	2 Phenylobacterium zucineum HLK1* Gene: PHZ_p0225: Copper resistance protein Site: position = -129 score = 6.14697 sequence = ACCTTCCCACTATTGGAAGGT Gene: PHZ_c1481: Copper resistance protein	Copper resistance protein
copD	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_2516: Putative copper export protein	Caulobacter sp. K31 Gene: Caul_2346: Putative copper export protein	2 Phenylobacterium zucineum HLK1 Gene: PHZ_c1480: Putative copper export protein Gene: PHZ_p0224: Putative copper export protein	Putative copper export protein

CRON 3.
cueO	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -42 score = 5.04308 sequence = TCCTTCCCATCATTGGAATCT Gene: Caul_2311: Multicopper oxidase	Phenylobacterium zucineum HLK1	Multicopper oxidase

CRON 4.
copZ	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -28 score = 5.46701 sequence = ACCTTGCCATGATGGGAAGCC Gene: Caul_2321: Copper chaperone	* Phenylobacterium zucineum HLK1 Site: position = -41 score = 5.62722 sequence = ACCCTCCCACTGTGGGAAGCT Gene: PHZ_c1479: Copper chaperone	Copper chaperone

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CueR - Caulobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --