Regulog CueR - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | ||
| Caulobacter segnis ATCC 21756 | ||
| Caulobacter sp. K31 | 4 | 3 |
| Phenylobacterium zucineum HLK1 | 7 | 4 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| copA |
|
|
*
Caulobacter sp. K31 Site: position = -56 score = 5.63722 sequence = ACCTTCCCATGATGGGAGGGA Gene: Caul_2317: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*2
Phenylobacterium zucineum HLK1 Site: position = -59 score = 5.14251 sequence = ACCCTCCCATGGTGGGAAACT Gene: PHZ_c1469: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -59 score = 6.00829 sequence = ACCCTCCCATCATGGGAAGGT Gene: PHZ_p0211: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR |
|
|
Gene: Caul_2318: Copper-responsive transcriptional regulator, MerR family |
2
Phenylobacterium zucineum HLK1 Gene: PHZ_c1468: Copper-responsive transcriptional regulator, MerR family Gene: PHZ_p0210: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
| CRON 2. | |||||
| copC |
|
Gene: Cseg_2515: Copper resistance protein |
Gene: Caul_2347: Copper resistance protein |
*2
Phenylobacterium zucineum HLK1 Gene: PHZ_p0225: Copper resistance protein Site: position = -129 score = 6.14697 sequence = ACCTTCCCACTATTGGAAGGT Gene: PHZ_c1481: Copper resistance protein |
Copper resistance protein |
| copD |
|
Gene: Cseg_2516: Putative copper export protein |
Gene: Caul_2346: Putative copper export protein |
2
Phenylobacterium zucineum HLK1 Gene: PHZ_c1480: Putative copper export protein Gene: PHZ_p0224: Putative copper export protein |
Putative copper export protein |
| CRON 3. | |||||
| cueO |
|
|
*
Caulobacter sp. K31 Site: position = -42 score = 5.04308 sequence = TCCTTCCCATCATTGGAATCT Gene: Caul_2311: Multicopper oxidase |
|
Multicopper oxidase |
| CRON 4. | |||||
| copZ |
|
|
*
Caulobacter sp. K31 Site: position = -28 score = 5.46701 sequence = ACCTTGCCATGATGGGAAGCC Gene: Caul_2321: Copper chaperone |
*
Phenylobacterium zucineum HLK1 Site: position = -41 score = 5.62722 sequence = ACCCTCCCACTGTGGGAAGCT Gene: PHZ_c1479: Copper chaperone |
Copper chaperone |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |