Regulon of CueR in Phenylobacterium zucineum HLK1

Properties
Regulator type:	Transcription factor
TF locus tag:	PHZ_p0210, PHZ_c1468
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Caulobacterales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 6.1 Sequence: ACCTTCCCACTATTGGAAGGT Locus tag: PHZ_c1481 Name: copC Funciton: Copper resistance protein Locus tag: PHZ_c1480 Name: copD Funciton: Putative copper export protein
	PHZ_c1481	copC	Copper resistance protein
	PHZ_c1480	copD	Putative copper export protein
Position: -41 Score: 5.6 Sequence: ACCCTCCCACTGTGGGAAGCT Locus tag: PHZ_c1479 Name: copZ Funciton: Copper chaperone
	PHZ_c1479	copZ	Copper chaperone
Position: -59 Score: 5.1 Sequence: ACCCTCCCATGGTGGGAAACT Locus tag: PHZ_c1469 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PHZ_c1468 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	PHZ_c1469	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	PHZ_c1468	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -59 Score: 6 Sequence: ACCCTCCCATCATGGGAAGGT Locus tag: PHZ_p0211 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PHZ_p0210 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	PHZ_p0211	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	PHZ_p0210	cueR	Copper-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD