Regulon of CueR in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_2318
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Caulobacterales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5.6 Sequence: ACCTTCCCATGATGGGAGGGA Locus tag: Caul_2317 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Caul_2318 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	Caul_2317	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Caul_2318	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -42 Score: 5 Sequence: TCCTTCCCATCATTGGAATCT Locus tag: Caul_2311 Name: cueO Funciton: Multicopper oxidase
	Caul_2311	cueO	Multicopper oxidase
Position: -28 Score: 5.5 Sequence: ACCTTGCCATGATGGGAAGCC Locus tag: Caul_2321 Name: copZ Funciton: Copper chaperone
	Caul_2321	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD