Regulog CueR - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | ||
| Magnetospirillum magnetotacticum MS-1 | 5 | 4 |
| Magnetospirillum magneticum AMB-1 | 3 | 2 |
| Azospirillum sp. B510 | 2 | 1 |
| Rhodospirillum centenum SW | ||
| Gluconacetobacter diazotrophicus PAl 5 | ||
| Acetobacter pasteurianus IFO 3283-01 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| copZ2 |
|
*
Magnetospirillum magnetotacticum MS-1 Site: position = -58 score = 5.40546 sequence = ACCTTCCCACCATGGGAACGA Gene: Magn03006555: Copper chaperone |
|
|
|
|
|
|
|
Copper chaperone |
| CRON 2. | ||||||||||
| copA |
Gene: Rru_A1894: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Magnetospirillum magnetotacticum MS-1 Site: position = -60 score = 5.79722 sequence = ACCTTCCAGTGACTGGAAGGT Gene: Magn03009759: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Magnetospirillum magneticum AMB-1 Site: position = -26 score = 5.89365 sequence = ACCTTCCCGTTGCTGGAAGGT Gene: amb1807: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Azospirillum sp. B510 Site: position = -62 score = 4.90964 sequence = ACCTTCCAGCGGCTGGAAGCC Gene: AZL_a03850: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
Gene: GbCGDNIH1_2089: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR |
|
Gene: Magn03009758: Copper-responsive transcriptional regulator, MerR family |
Gene: amb1808: Copper-responsive transcriptional regulator, MerR family |
Gene: AZL_a03860: Copper-responsive transcriptional regulator, MerR family |
Gene: RC1_0106: Copper-responsive transcriptional regulator, MerR family |
|
|
|
Gene: GbCGDNIH1_2090: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
| CRON 3. | ||||||||||
| copA2 |
|
*
Magnetospirillum magnetotacticum MS-1 Site: position = -127 score = 5.08284 sequence = ACCTTCCCATTGTAGGAAGCC Gene: Magn03006556: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| CRON 4. | ||||||||||
| copZ |
Gene: Rru_A1892: Copper chaperone |
*
Magnetospirillum magnetotacticum MS-1 Site: position = -61 score = 5.48208 sequence = ACCTTCCATCGGCTGGAAGGT Gene: Magn03009756: Copper chaperone |
*
Magnetospirillum magneticum AMB-1 Site: position = -61 score = 5.19423 sequence = ACCTTCCATGGGCTGGAAGGT Gene: amb1810: Copper chaperone |
Gene: AZL_015970: Copper chaperone |
Gene: RC1_0108: Copper chaperone |
|
|
|
|
Copper chaperone |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |