Statistics of regulated genes

Genome	Genes	Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1	5	4
Magnetospirillum magneticum AMB-1	3	2
Azospirillum sp. B510	2	1
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes										Function
CRON 1.
copZ2	Rhodospirillum rubrum ATCC 11170	* Magnetospirillum magnetotacticum MS-1 Site: position = -58 score = 5.40546 sequence = ACCTTCCCACCATGGGAACGA Gene: Magn03006555: Copper chaperone	Magnetospirillum magneticum AMB-1	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Copper chaperone
CRON 2.
copA	Rhodospirillum rubrum ATCC 11170 Gene: Rru_A1894: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Magnetospirillum magnetotacticum MS-1 Site: position = -60 score = 5.79722 sequence = ACCTTCCAGTGACTGGAAGGT Gene: Magn03009759: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Magnetospirillum magneticum AMB-1 Site: position = -26 score = 5.89365 sequence = ACCTTCCCGTTGCTGGAAGGT Gene: amb1807: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Azospirillum sp. B510 Site: position = -62 score = 4.90964 sequence = ACCTTCCAGCGGCTGGAAGCC Gene: AZL_a03850: Copper-translocating P-type ATPase (EC 3.6.3.4)	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1 Gene: GbCGDNIH1_2089: Copper-translocating P-type ATPase (EC 3.6.3.4)	Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR	Rhodospirillum rubrum ATCC 11170	Magnetospirillum magnetotacticum MS-1 Gene: Magn03009758: Copper-responsive transcriptional regulator, MerR family	Magnetospirillum magneticum AMB-1 Gene: amb1808: Copper-responsive transcriptional regulator, MerR family	Azospirillum sp. B510 Gene: AZL_a03860: Copper-responsive transcriptional regulator, MerR family	Rhodospirillum centenum SW Gene: RC1_0106: Copper-responsive transcriptional regulator, MerR family	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1 Gene: GbCGDNIH1_2090: Copper-responsive transcriptional regulator, MerR family	Copper-responsive transcriptional regulator, MerR family
CRON 3.
copA2	Rhodospirillum rubrum ATCC 11170	* Magnetospirillum magnetotacticum MS-1 Site: position = -127 score = 5.08284 sequence = ACCTTCCCATTGTAGGAAGCC Gene: Magn03006556: Copper-translocating P-type ATPase (EC 3.6.3.4)	Magnetospirillum magneticum AMB-1	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Copper-translocating P-type ATPase (EC 3.6.3.4)
CRON 4.
copZ	Rhodospirillum rubrum ATCC 11170 Gene: Rru_A1892: Copper chaperone	* Magnetospirillum magnetotacticum MS-1 Site: position = -61 score = 5.48208 sequence = ACCTTCCATCGGCTGGAAGGT Gene: Magn03009756: Copper chaperone	* Magnetospirillum magneticum AMB-1 Site: position = -61 score = 5.19423 sequence = ACCTTCCATGGGCTGGAAGGT Gene: amb1810: Copper chaperone	Azospirillum sp. B510 Gene: AZL_015970: Copper chaperone	Rhodospirillum centenum SW Gene: RC1_0108: Copper chaperone	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Copper chaperone

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD