Regulon of CueR in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03009758
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -127 Score: 5.1 Sequence: ACCTTCCCATTGTAGGAAGCC Locus tag: Magn03006556 Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Magn03006556	copA2	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -58 Score: 5.4 Sequence: ACCTTCCCACCATGGGAACGA Locus tag: Magn03006555 Name: copZ2 Funciton: Copper chaperone
	Magn03006555	copZ2	Copper chaperone
Position: -61 Score: 5.5 Sequence: ACCTTCCATCGGCTGGAAGGT Locus tag: Magn03009756 Name: copZ Funciton: Copper chaperone
	Magn03009756	copZ	Copper chaperone
Position: -60 Score: 5.8 Sequence: ACCTTCCAGTGACTGGAAGGT Locus tag: Magn03009759 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Magn03009758 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	Magn03009759	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Magn03009758	cueR	Copper-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD