Regulon of CueR in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_a03860
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhodospirillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 4.9 Sequence: ACCTTCCAGCGGCTGGAAGCC Locus tag: AZL_a03850 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: AZL_a03860 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	AZL_a03850	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	AZL_a03860	cueR	Copper-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD