Regulog CueR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | 12 | 5 |
| Rhizobium sp. NGR234 | 14 | 5 |
| Rhizobium leguminosarum bv. viciae 3841 | 4 | 2 |
| Rhizobium etli CFN 42 | 2 | 1 |
| Agrobacterium tumefaciens str. C58 (Cereon) | 5 | 2 |
| Mesorhizobium sp. BNC1 | 5 | 3 |
| Mesorhizobium loti MAFF303099 | 1 | 1 |
| Brucella melitensis 16M | 2 | 2 |
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| copA |
*2
Sinorhizobium meliloti 1021 Site: position = -55 score = 5.86085 sequence = ACCTTCCCATTATTGGAAGGA Gene: SMb21578: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -57 score = 5.57237 sequence = ACCTTACCATTGTTGGAAGGA Gene: SMa1013: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*3
Rhizobium sp. NGR234 Site: position = -57 score = 5.57237 sequence = ACCTTACCATTGTTGGAAGGA Gene: NGR_b08430: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -58 score = 4.52683 sequence = ACCTTCCGACCGTTGTAAGCC Gene: NGR_b07400: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -58 score = 5.30739 sequence = ACCTTCCCACCGTTGGAAGCC Gene: NGR_b12440: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*2
Rhizobium leguminosarum bv. viciae 3841 Site: position = -64 score = 5.71226 sequence = ACCTTCCAGTCGCTGGAAGGT Gene: pRL110010: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -56 score = 5.47744 sequence = ACCTTCCCATCATAGGAAGGA Gene: pRL110331: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Rhizobium etli CFN 42 Site: position = -63 score = 5.74921 sequence = ACCTTCCAGTTGCTGGAAGGT Gene: RHE_PE00007: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*2
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -54 score = 5.38205 sequence = ACCTTGCCACGATGGGAAGCC Gene: Atu1195: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -110 score = 5.62174 sequence = ACCTTCCCATCATGGGAAGCC Gene: Atu0937: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*2
Mesorhizobium sp. BNC1 Site: position = -49 score = 5.4631 sequence = ACCTTCCAGTAACTGGAAGGA Gene: Meso_2667: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -66 score = 5.39235 sequence = ACCTTCCCATCGTTGGAAGCC Site: position = -115 score = 5.30739 sequence = GGCTTCCCACCGTTGGAAGGT Gene: Meso_3893: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Mesorhizobium loti MAFF303099 Site: position = -62 score = 5.215 sequence = ACCTTCCAGTTACTGGAAGCA Gene: mlr5325: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Brucella melitensis 16M Site: position = -77 score = 5.35626 sequence = ACCTTCCAACGGTTGGAAGGG Gene: BMEI1730: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| COG2871 |
|
Gene: NGR_b07390: Putative oxidoreductase |
|
|
Gene: Atu1196: Putative oxidoreductase |
|
|
|
|
|
|
|
|
|
|
Putative oxidoreductase |
| cueR |
2
Sinorhizobium meliloti 1021 Gene: SMb21579: Copper-responsive transcriptional regulator, MerR family Gene: SMa1014: Copper-responsive transcriptional regulator, MerR family |
3
Rhizobium sp. NGR234 Gene: NGR_b07380: Copper-responsive transcriptional regulator, MerR family Gene: NGR_b12430: Copper-responsive transcriptional regulator, MerR family Gene: NGR_b08420: Copper-responsive transcriptional regulator, MerR family |
2
Rhizobium leguminosarum bv. viciae 3841 Gene: pRL110009: Copper-responsive transcriptional regulator, MerR family Gene: pRL110330: Copper-responsive transcriptional regulator, MerR family |
Gene: RHE_PE00006: Copper-responsive transcriptional regulator, MerR family |
2
Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu1197: Copper-responsive transcriptional regulator, MerR family Gene: Atu0938: Copper-responsive transcriptional regulator, MerR family |
Gene: Meso_3892: Copper-responsive transcriptional regulator, MerR family |
|
Gene: BMEI1729: Copper-responsive transcriptional regulator, MerR family |
|
|
|
|
|
|
|
Copper-responsive transcriptional regulator, MerR family |
| cueO |
|
Gene: NGR_b07370: Multicopper oxidase |
|
|
|
|
|
|
|
|
|
|
|
|
|
Multicopper oxidase |
| copG |
|
|
|
|
|
Gene: Meso_3891: Predicted metal binding protein |
|
|
|
|
|
|
|
|
|
Predicted metal binding protein |
| CRON 2. | ||||||||||||||||
| PF11162 |
*
Sinorhizobium meliloti 1021 Site: position = -147 score = 5.03409 sequence = ACCTTGCCATCGTTGTAAGCC Gene: SMc02279: Hypothetical protein |
*
Rhizobium sp. NGR234 Site: position = -135 score = 4.75459 sequence = ACCTTACCATCGTTGGAAACA Gene: NGR_b08300: Hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| SMc02280 |
Gene: SMc02280: Hypothetical protein |
Gene: NGR_b08290: Hypothetical protein |
|
|
|
|
|
|
|
|
Gene: bsl2212: Hypothetical protein |
Gene: BBta_6517: Hypothetical protein |
|
|
|
Hypothetical protein |
| copB |
Gene: SMc02281: Copper tolerance outer membrane protein |
Gene: NGR_b08280: Copper tolerance outer membrane protein |
|
|
Gene: Atu3992: Copper tolerance outer membrane protein |
|
|
|
|
|
Gene: bll2211: Copper tolerance outer membrane protein |
Gene: BBta_6518: Copper tolerance outer membrane protein |
|
|
|
Copper tolerance outer membrane protein |
| cueO |
Gene: SMc02282: Multicopper oxidase |
Gene: NGR_b08270: Multicopper oxidase |
|
|
Gene: Atu3991: Multicopper oxidase |
|
|
|
|
|
Gene: bll2210: Multicopper oxidase |
Gene: BBta_6519: Multicopper oxidase |
|
|
|
Multicopper oxidase |
| copC |
Gene: SMc02283: Cupredoxin |
Gene: NGR_b08260: Cupredoxin |
|
|
Gene: Atu3990: Cupredoxin |
|
|
|
|
|
Gene: bll2209: Cupredoxin |
Gene: BBta_6520: Cupredoxin |
|
|
|
Cupredoxin |
| cusF |
Gene: SMc02284: Heavy metal efflux RND periplasmic protein |
Gene: NGR_b08250: Heavy metal efflux RND periplasmic protein |
|
|
|
|
|
|
|
|
Gene: bll2208: Heavy metal efflux RND periplasmic protein |
Gene: BBta_6521: Heavy metal efflux RND periplasmic protein |
|
|
|
Heavy metal efflux RND periplasmic protein |
| CRON 3. | ||||||||||||||||
| copZ |
*2
Sinorhizobium meliloti 1021 Site: position = -57 score = 5.70718 sequence = ACCTTGCCATCGTTGGAAGCT Gene: SMb20560: Copper chaperone Site: position = -59 score = 4.6501 sequence = ACCTTGCCATCGTTGGAAACG Gene: SMa1009: Copper chaperone |
*
Rhizobium sp. NGR234 Site: position = -57 score = 4.9065 sequence = ACCCTGCCATCGTTGGAAGCC Gene: NGR_b08480: Copper chaperone |
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -35 score = 5.30739 sequence = ACCTTCCAACGGTGGGAAGCC Gene: Meso_3894: Copper chaperone |
|
*
Brucella melitensis 16M Site: position = -59 score = 5.85162 sequence = ACCTTGCCACGATGGGAAGCT Gene: BMEI1032: Copper chaperone |
|
|
|
|
|
|
|
Copper chaperone |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |