Regulon of CueR in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_4039, Meso_3892
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.5 Sequence: ACCTTCCAGTAACTGGAAGGA Locus tag: Meso_2667 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Meso_2667	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -35 Score: 5.3 Sequence: ACCTTCCAACGGTGGGAAGCC Locus tag: Meso_3894 Name: copZ Funciton: Copper chaperone
	Meso_3894	copZ	Copper chaperone
Position: -115 Score: 5.3 Sequence: GGCTTCCCACCGTTGGAAGGT Position: -66 Score: 5.4 Sequence: ACCTTCCCATCGTTGGAAGCC Locus tag: Meso_3893 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Meso_3892 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family Locus tag: Meso_3891 Name: copG Funciton: Predicted metal binding protein
	Meso_3893	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Meso_3892	cueR	Copper-responsive transcriptional regulator, MerR family
	Meso_3891	copG	Predicted metal binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD