Regulon of CueR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb21579, SMa1014
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhizobiales
Statistics of regulated genes:
- Genes	12
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5.9 Sequence: ACCTTCCCATTATTGGAAGGA Locus tag: SMb21578 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SMb21579 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	SMb21578	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	SMb21579	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -57 Score: 5.6 Sequence: ACCTTACCATTGTTGGAAGGA Locus tag: SMa1013 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SMa1014 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	SMa1013	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	SMa1014	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -147 Score: 5 Sequence: ACCTTGCCATCGTTGTAAGCC Locus tag: SMc02279 Name: PF11162 Funciton: Hypothetical protein Locus tag: SMc02280 Name: null Funciton: Hypothetical protein Locus tag: SMc02281 Name: copB Funciton: Copper tolerance outer membrane protein Locus tag: SMc02282 Name: cueO Funciton: Multicopper oxidase Locus tag: SMc02283 Name: copC Funciton: Cupredoxin Locus tag: SMc02284 Name: cusF Funciton: Heavy metal efflux RND periplasmic protein
	SMc02279	PF11162	Hypothetical protein
	SMc02280		Hypothetical protein
	SMc02281	copB	Copper tolerance outer membrane protein
	SMc02282	cueO	Multicopper oxidase
	SMc02283	copC	Cupredoxin
	SMc02284	cusF	Heavy metal efflux RND periplasmic protein
Position: -59 Score: 4.7 Sequence: ACCTTGCCATCGTTGGAAACG Locus tag: SMa1009 Name: copZ Funciton: Copper chaperone
	SMa1009	copZ	Copper chaperone
Position: -57 Score: 5.7 Sequence: ACCTTGCCATCGTTGGAAGCT Locus tag: SMb20560 Name: copZ Funciton: Copper chaperone
	SMb20560	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD