Regulon of CueR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	pRL110009, pRL110330
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5.5 Sequence: ACCTTCCCATCATAGGAAGGA Locus tag: pRL110331 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: pRL110330 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	pRL110331	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	pRL110330	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -64 Score: 5.7 Sequence: ACCTTCCAGTCGCTGGAAGGT Locus tag: pRL110010 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: pRL110009 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	pRL110010	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	pRL110009	cueR	Copper-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD