Regulog CueR - Psychromonadaceae/Aeromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Statistics of regulated genes
Genome	Genes	Operons
Psychromonas ingrahamii 37	4	2
Psychromonas sp. CNPT3	6	2
Moritella sp. PE36	9	3
Aeromonas hydrophila subsp. hydrophila ATCC 7966	2	1
Aeromonas salmonicida subsp. salmonicida A449	2	1
Tolumonas auensis DSM 9187	3	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
copZ	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	* Tolumonas auensis DSM 9187 Site: position = -56 score = 5.87508 sequence = ACCTTCCAATAGAGGGAAGGT Gene: Tola_0588: Copper chaperone	Copper chaperone

CRON 2.
copA	* Psychromonas ingrahamii 37 Site: position = -62 score = 4.76821 sequence = ACCTTACCCTAAGGGTAATGG Gene: Ping_1340: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Psychromonas sp. CNPT3 Site: position = -59 score = 4.45975 sequence = ACCTTAACCTATGGGTAAGGG Gene: PCNPT3_05574: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Moritella sp. PE36 Site: position = -62 score = 4.62377 sequence = ACCTTACACTAAGGGTAAAGG Gene: PE36_15557: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -70 score = 3.75082 sequence = CCCTTACAGTAAAGGTTAGGG Gene: AHA_4222: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Aeromonas salmonicida subsp. salmonicida A449 Site: position = -75 score = 3.97456 sequence = AGCTTACCCTTACAGTAAAGG Site: position = -69 score = 3.75082 sequence = CCCTTACAGTAAAGGTTAGGG Gene: ASA_0103: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Tolumonas auensis DSM 9187 Site: position = -60 score = 5.27321 sequence = ACCTTGCCATGATGTCAAGGC Gene: Tola_0589: Copper-translocating P-type ATPase (EC 3.6.3.4)	Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR	Psychromonas ingrahamii 37 Gene: Ping_1339: Copper-responsive transcriptional regulator, MerR family	Psychromonas sp. CNPT3 Gene: PCNPT3_05569: Copper-responsive transcriptional regulator, MerR family	Moritella sp. PE36 Gene: PE36_15562: Copper-responsive transcriptional regulator, MerR family	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_4221: Copper-responsive transcriptional regulator, MerR family	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_0104: Copper-responsive transcriptional regulator, MerR family	Tolumonas auensis DSM 9187 Gene: Tola_0590: Copper-responsive transcriptional regulator, MerR family	Copper-responsive transcriptional regulator, MerR family

CRON 3.
PCNPT3_11152	Psychromonas ingrahamii 37	* Psychromonas sp. CNPT3 Site: position = -56 score = 4.56347 sequence = ACCTTACCGTTAGGGGAGCTT Gene: PCNPT3_11152: hypothetical protein	* Moritella sp. PE36 Site: position = -68 score = 4.92515 sequence = ACCTTCCCCTTAAGGTAAAGA Gene: PE36_15789: hypothetical protein	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	hypothetical protein
cuzC	Psychromonas ingrahamii 37 Gene: Ping_1368: Heavy metal RND efflux outer membrane protein	Psychromonas sp. CNPT3 Gene: PCNPT3_11147: Heavy metal RND efflux outer membrane protein	Moritella sp. PE36 Gene: PE36_15784: Heavy metal RND efflux outer membrane protein	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Heavy metal RND efflux outer membrane protein
cusB	Psychromonas ingrahamii 37 Gene: Ping_1369: Heavy metal RND efflux periplasmic protein	Psychromonas sp. CNPT3 Gene: PCNPT3_11142: Heavy metal RND efflux periplasmic protein	Moritella sp. PE36 Gene: PE36_15779: Heavy metal RND efflux periplasmic protein	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Heavy metal RND efflux periplasmic protein
cusA	Psychromonas ingrahamii 37 Gene: Ping_1370: Heavy metal RND efflux inner membrane protein	Psychromonas sp. CNPT3 Gene: PCNPT3_11137: Heavy metal RND efflux inner membrane protein	Moritella sp. PE36 Gene: PE36_15774: Heavy metal RND efflux inner membrane protein	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Heavy metal RND efflux inner membrane protein
Ping_1371	Psychromonas ingrahamii 37 Gene: Ping_1371: putative copper resistance protein	Psychromonas sp. CNPT3	Moritella sp. PE36 Gene: PE36_15769: putative copper resistance protein	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	putative copper resistance protein

CRON 4.
copA2	* Psychromonas ingrahamii 37 Site: position = -69 score = 4.63413 sequence = ACCTTCCCCTAAGAGTAATGA Gene: Ping_1381: Copper-translocating P-type ATPase (EC 3.6.3.4)	Psychromonas sp. CNPT3	* Moritella sp. PE36 Site: position = -182 score = 4.29451 sequence = GGTTTACCTTAGCTGGAAGGT Site: position = -97 score = 4.77265 sequence = ACCTTCCAGTTAGGGTAAAGG Gene: PE36_19605: Copper-translocating P-type ATPase (EC 3.6.3.4)	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Copper-translocating P-type ATPase (EC 3.6.3.4)
COG4633	Psychromonas ingrahamii 37 Gene: Ping_1382: Putative cupredoxin	Psychromonas sp. CNPT3	Moritella sp. PE36 Gene: PE36_19610: Putative cupredoxin	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Putative cupredoxin

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CueR - Psychromonadaceae/Aeromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --