Regulog CueR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 4 | 2 |
| Psychromonas sp. CNPT3 | 6 | 2 |
| Moritella sp. PE36 | 9 | 3 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 2 | 1 |
| Aeromonas salmonicida subsp. salmonicida A449 | 2 | 1 |
| Tolumonas auensis DSM 9187 | 3 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| copZ |
|
|
|
|
|
*
Tolumonas auensis DSM 9187 Site: position = -56 score = 5.87508 sequence = ACCTTCCAATAGAGGGAAGGT Gene: Tola_0588: Copper chaperone |
Copper chaperone |
| CRON 2. | |||||||
| copA |
*
Psychromonas ingrahamii 37 Site: position = -62 score = 4.76821 sequence = ACCTTACCCTAAGGGTAATGG Gene: Ping_1340: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Psychromonas sp. CNPT3 Site: position = -59 score = 4.45975 sequence = ACCTTAACCTATGGGTAAGGG Gene: PCNPT3_05574: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Moritella sp. PE36 Site: position = -62 score = 4.62377 sequence = ACCTTACACTAAGGGTAAAGG Gene: PE36_15557: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -70 score = 3.75082 sequence = CCCTTACAGTAAAGGTTAGGG Gene: AHA_4222: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -75 score = 3.97456 sequence = AGCTTACCCTTACAGTAAAGG Site: position = -69 score = 3.75082 sequence = CCCTTACAGTAAAGGTTAGGG Gene: ASA_0103: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Tolumonas auensis DSM 9187 Site: position = -60 score = 5.27321 sequence = ACCTTGCCATGATGTCAAGGC Gene: Tola_0589: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR |
Gene: Ping_1339: Copper-responsive transcriptional regulator, MerR family |
Gene: PCNPT3_05569: Copper-responsive transcriptional regulator, MerR family |
Gene: PE36_15562: Copper-responsive transcriptional regulator, MerR family |
Gene: AHA_4221: Copper-responsive transcriptional regulator, MerR family |
Gene: ASA_0104: Copper-responsive transcriptional regulator, MerR family |
Gene: Tola_0590: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
| CRON 3. | |||||||
| PCNPT3_11152 |
|
*
Psychromonas sp. CNPT3 Site: position = -56 score = 4.56347 sequence = ACCTTACCGTTAGGGGAGCTT Gene: PCNPT3_11152: hypothetical protein |
*
Moritella sp. PE36 Site: position = -68 score = 4.92515 sequence = ACCTTCCCCTTAAGGTAAAGA Gene: PE36_15789: hypothetical protein |
|
|
|
hypothetical protein |
| cuzC |
Gene: Ping_1368: Heavy metal RND efflux outer membrane protein |
Gene: PCNPT3_11147: Heavy metal RND efflux outer membrane protein |
Gene: PE36_15784: Heavy metal RND efflux outer membrane protein |
|
|
|
Heavy metal RND efflux outer membrane protein |
| cusB |
Gene: Ping_1369: Heavy metal RND efflux periplasmic protein |
Gene: PCNPT3_11142: Heavy metal RND efflux periplasmic protein |
Gene: PE36_15779: Heavy metal RND efflux periplasmic protein |
|
|
|
Heavy metal RND efflux periplasmic protein |
| cusA |
Gene: Ping_1370: Heavy metal RND efflux inner membrane protein |
Gene: PCNPT3_11137: Heavy metal RND efflux inner membrane protein |
Gene: PE36_15774: Heavy metal RND efflux inner membrane protein |
|
|
|
Heavy metal RND efflux inner membrane protein |
| Ping_1371 |
Gene: Ping_1371: putative copper resistance protein |
|
Gene: PE36_15769: putative copper resistance protein |
|
|
|
putative copper resistance protein |
| CRON 4. | |||||||
| copA2 |
*
Psychromonas ingrahamii 37 Site: position = -69 score = 4.63413 sequence = ACCTTCCCCTAAGAGTAATGA Gene: Ping_1381: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
*
Moritella sp. PE36 Site: position = -182 score = 4.29451 sequence = GGTTTACCTTAGCTGGAAGGT Site: position = -97 score = 4.77265 sequence = ACCTTCCAGTTAGGGTAAAGG Gene: PE36_19605: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| COG4633 |
Gene: Ping_1382: Putative cupredoxin |
|
Gene: PE36_19610: Putative cupredoxin |
|
|
|
Putative cupredoxin |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |