Regulon of CueR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_15562
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 4.9 Sequence: ACCTTCCCCTTAAGGTAAAGA Locus tag: PE36_15789 Name: PCNPT3_11152 Funciton: hypothetical protein Locus tag: PE36_15784 Name: cuzC Funciton: Heavy metal RND efflux outer membrane protein Locus tag: PE36_15779 Name: cusB Funciton: Heavy metal RND efflux periplasmic protein Locus tag: PE36_15774 Name: cusA Funciton: Heavy metal RND efflux inner membrane protein Locus tag: PE36_15769 Name: null Funciton: putative copper resistance protein
	PE36_15789	PCNPT3_11152	hypothetical protein
	PE36_15784	cuzC	Heavy metal RND efflux outer membrane protein
	PE36_15779	cusB	Heavy metal RND efflux periplasmic protein
	PE36_15774	cusA	Heavy metal RND efflux inner membrane protein
	PE36_15769		putative copper resistance protein
Position: -62 Score: 4.6 Sequence: ACCTTACACTAAGGGTAAAGG Locus tag: PE36_15557 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PE36_15562 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	PE36_15557	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	PE36_15562	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -182 Score: 4.3 Sequence: GGTTTACCTTAGCTGGAAGGT Position: -97 Score: 4.8 Sequence: ACCTTCCAGTTAGGGTAAAGG Locus tag: PE36_19605 Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PE36_19610 Name: COG4633 Funciton: Putative cupredoxin
	PE36_19605	copA2	Copper-translocating P-type ATPase (EC 3.6.3.4)
	PE36_19610	COG4633	Putative cupredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD