Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Ping_1371 gene

Properties
Regulog: CueR - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Moritella sp. PE36
Position: -68
Score: 4.92515
Sequence: ACCTTCCCCTTAAGGTAAAGA
Locus tag: PE36_15789
Name: PCNPT3_11152
Funciton: hypothetical protein
Locus tag: PE36_15784
Name: cuzC
Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: PE36_15779
Name: cusB
Funciton: Heavy metal RND efflux periplasmic protein
Locus tag: PE36_15774
Name: cusA
Funciton: Heavy metal RND efflux inner membrane protein
Locus tag: PE36_15769
Name: null
Funciton: putative copper resistance protein
PCNPT3_11152-cuzC-cusB-cusA-PE36_15769 -68 4.9 ACCTTCCCCTTAAGGTAAAGA PE36_15789