Regulon of CueR in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_1385, Ping_1339
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 4.8 Sequence: ACCTTACCCTAAGGGTAATGG Locus tag: Ping_1340 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Ping_1339 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	Ping_1340	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Ping_1339	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -69 Score: 4.6 Sequence: ACCTTCCCCTAAGAGTAATGA Locus tag: Ping_1381 Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Ping_1382 Name: COG4633 Funciton: Putative cupredoxin
	Ping_1381	copA2	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Ping_1382	COG4633	Putative cupredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD