Regulog CueR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | 3 | 2 |
| Vibrio vulnificus CMCP6 | 8 | 3 |
| Vibrio harveyi ATCC BAA-1116 | 8 | 3 |
| Vibrio parahaemolyticus RIMD 2210633 | 9 | 3 |
| Vibrio shilonii AK1 | 7 | 2 |
| Vibrio splendidus LGP32 | 5 | 1 |
| Vibrio fischeri ES114 | 8 | 3 |
| Vibrio salmonicida LFI1238 | 8 | 3 |
| Vibrio angustum S14 | 2 | 2 |
| Photobacterium profundum SS9 | 7 | 3 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| cueR |
Gene: VC0974: Copper-responsive transcriptional regulator, MerR family |
Gene: VV20113: Copper-responsive transcriptional regulator, MerR family |
Gene: VIBHAR_06131: Copper-responsive transcriptional regulator, MerR family |
Gene: VPA0662: Copper-responsive transcriptional regulator, MerR family |
Gene: VSAK1_08833: Copper-responsive transcriptional regulator, MerR family |
Gene: VS_2283: Copper-responsive transcriptional regulator, MerR family |
*
Vibrio fischeri ES114 Site: position = -46 score = 5.48541 sequence = ACCTTACAGTTAATGGAAGGT Gene: VF_0782: Copper-responsive transcriptional regulator, MerR family |
*
Vibrio salmonicida LFI1238 Site: position = -47 score = 5.48541 sequence = ACCTTACAGTAAATGGAAGGT Gene: VSAL_I0803: Copper-responsive transcriptional regulator, MerR family |
*
Vibrio angustum S14 Site: position = -73 score = 5.21019 sequence = ACCTTCTAGTTACTGTAAGGT Gene: VAS14_16481: Copper-responsive transcriptional regulator, MerR family |
*
Photobacterium profundum SS9 Site: position = -82 score = 4.74729 sequence = ACCTTCTGGTTGGTGTAAGGT Gene: PBPRA2823: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
| CRON 2. | |||||||||||
| PF00034 |
|
*
Vibrio vulnificus CMCP6 Site: position = -58 score = 5.73614 sequence = AGCTTCCCCTTAGGGGAAGCT Gene: VV20052: Cytochrome c553 |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -64 score = 5.73614 sequence = AGCTTCCCCTAAGGGGAAGCT Gene: VIBHAR_05667: Cytochrome c553 |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = 3 score = 5.73614 sequence = AGCTTCCCCTTAGGGGAAGCT Gene: VPA1012: Cytochrome c553 |
|
|
|
|
|
|
Cytochrome c553 |
| CRON 3. | |||||||||||
| VCA0262 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -57 score = 4.52231 sequence = ACCTTCCCCTAGGGTAAAACT Gene: VCA0262: Conserved hypothetical protein |
*
Vibrio vulnificus CMCP6 Site: position = -102 score = 4.8515 sequence = ACCTTACCCTAGGGTAAAGCT Gene: VV20849: Conserved hypothetical protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -58 score = 5.01562 sequence = ACCTTCCCCTAAGGTTAACCT Gene: VIBHAR_06363: Conserved hypothetical protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -72 score = 4.68512 sequence = ACTTTCCCCCTAGGGTAACCT Gene: VPA0484: Conserved hypothetical protein |
*3
Vibrio shilonii AK1 Gene: VSAK1_07509: Conserved hypothetical protein Gene: VSAK1_07549: Conserved hypothetical protein Site: position = -56 score = 5.90122 sequence = ACCTTCCCCTTAGGGGAGGGT Gene: VSAK1_10308: Conserved hypothetical protein |
*
Vibrio splendidus LGP32 Site: position = -53 score = 5.55089 sequence = ACCTTACCCTAAGGGGAACGT Gene: VS_II0513: Conserved hypothetical protein |
*
Vibrio fischeri ES114 Site: position = -50 score = 5.50869 sequence = ACCTTCCCCTAAGTGGAGGCT Gene: VF_A0442: Conserved hypothetical protein |
*
Vibrio salmonicida LFI1238 Site: position = -59 score = 5.41482 sequence = ACCTTACCCTAAGTGGAAGGC Gene: VSAL_II0717: Conserved hypothetical protein |
|
*
Photobacterium profundum SS9 Site: position = -201 score = 5.47173 sequence = ACCTTACCCTTAGGGAAAGGT Gene: PBPRA1006: Conserved hypothetical protein |
Conserved hypothetical protein |
| VPA0483 |
|
|
|
Gene: VPA0483: unknown |
|
|
|
|
|
|
unknown |
| cusC |
|
Gene: VV20850: Heavy metal RND efflux outer membrane protein, CzcC family |
Gene: VIBHAR_06364: Heavy metal RND efflux outer membrane protein, CzcC family |
Gene: VPA0482: Heavy metal RND efflux outer membrane protein, CzcC family |
2
Vibrio shilonii AK1 Gene: VSAK1_07514: Heavy metal RND efflux outer membrane protein, CzcC family Gene: VSAK1_10303: Heavy metal RND efflux outer membrane protein, CzcC family |
Gene: VS_II0514: Heavy metal RND efflux outer membrane protein, CzcC family |
Gene: VF_A0443: Heavy metal RND efflux outer membrane protein, CzcC family |
Gene: VSAL_II0716: Heavy metal RND efflux outer membrane protein, CzcC family |
|
Gene: PBPRA1005: Heavy metal RND efflux outer membrane protein, CzcC family |
Heavy metal RND efflux outer membrane protein, CzcC family |
| cusB |
|
Gene: VV20851: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
Gene: VIBHAR_06365: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
Gene: VPA0481: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
2
Vibrio shilonii AK1 Gene: VSAK1_07519: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family Gene: VSAK1_10298: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
Gene: VS_II0515: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
Gene: VF_A0444: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
Gene: VSAL_II0715: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
|
Gene: PBPRA1004: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family |
| cusA |
|
Gene: VV20852: Cation efflux system protein CusA, transmembrane protein |
Gene: VIBHAR_06366: Cation efflux system protein CusA, transmembrane protein |
Gene: VPA0480: Cation efflux system protein CusA, transmembrane protein |
2
Vibrio shilonii AK1 Gene: VSAK1_07524: Cation efflux system protein CusA, transmembrane protein Gene: VSAK1_10293: Cation efflux system protein CusA, transmembrane protein |
Gene: VS_II0516: Cation efflux system protein CusA, transmembrane protein |
Gene: VF_A0445: Cation efflux system protein CusA, transmembrane protein |
Gene: VSAL_II0714: Cation efflux system protein CusA, transmembrane protein |
|
Gene: PBPRA1003: Cation efflux system protein CusA, transmembrane protein |
Cation efflux system protein CusA, transmembrane protein |
| cusF |
|
Gene: VV20853: putative blue copper protein |
Gene: VIBHAR_06367: putative blue copper protein |
Gene: VPA0479: putative blue copper protein |
2
Vibrio shilonii AK1 Gene: VSAK1_07529: putative blue copper protein Gene: VSAK1_10288: putative blue copper protein |
Gene: VS_II0517: putative blue copper protein |
Gene: VF_A0446: putative blue copper protein |
Gene: VSAL_II0713: putative blue copper protein |
|
Gene: PBPRA1002: putative blue copper protein |
putative blue copper protein |
| CRON 4. | |||||||||||
| copA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -29 score = 5.33823 sequence = ACCTTACCTTAAGGTTAAGGT Gene: VC2215: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Vibrio vulnificus CMCP6 Site: position = -60 score = 5.8161 sequence = ACCTTCCCCCGGCGGCAAGGT Gene: VV1_0239: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -57 score = 5.60184 sequence = ACCTTCCCCTTGCAGGAAGGT Gene: VIBHAR_01268: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -58 score = 5.59954 sequence = ACCTTCCCCTTGATGTAAGGT Gene: VP0758: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Vibrio shilonii AK1 Site: position = -100 score = 5.68568 sequence = ACCTTACCCTTGCGGTAAGGT Gene: VSAK1_08868: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: VS_0768: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Vibrio fischeri ES114 Site: position = -60 score = 5.48541 sequence = ACCTTCCATTAACTGTAAGGT Gene: VF_0781: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Vibrio salmonicida LFI1238 Site: position = -61 score = 5.48541 sequence = ACCTTCCATTTACTGTAAGGT Gene: VSAL_I0802: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Vibrio angustum S14 Site: position = -107 score = 5.21019 sequence = ACCTTACAGTAACTAGAAGGT Gene: VAS14_16476: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Photobacterium profundum SS9 Site: position = -92 score = 4.74729 sequence = ACCTTACACCAACCAGAAGGT Gene: PBPRA2824: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| copG |
Gene: VC2216: Predicted metal-binding protein |
Gene: VV1_0240: Predicted metal-binding protein |
Gene: VIBHAR_01267: Predicted metal-binding protein |
Gene: VP0757: Predicted metal-binding protein |
Gene: VSAK1_08863: Predicted metal-binding protein |
Gene: VS_0767: Predicted metal-binding protein |
Gene: VF_0780: Predicted metal-binding protein |
Gene: VSAL_I0801: Predicted metal-binding protein |
Gene: VAS14_02436: Predicted metal-binding protein |
Gene: PBPRA1905: Predicted metal-binding protein |
Predicted metal-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |