Regulon of CueR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_08833
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Vibrionales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 5.7 Sequence: ACCTTACCCTTGCGGTAAGGT Locus tag: VSAK1_08868 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: VSAK1_08863 Name: copG Funciton: Predicted metal-binding protein
	VSAK1_08868	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	VSAK1_08863	copG	Predicted metal-binding protein
Position: -56 Score: 5.9 Sequence: ACCTTCCCCTTAGGGGAGGGT Locus tag: VSAK1_10308 Name: VCA0262 Funciton: Conserved hypothetical protein Locus tag: VSAK1_10303 Name: cusC Funciton: Heavy metal RND efflux outer membrane protein, CzcC family Locus tag: VSAK1_10298 Name: cusB Funciton: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family Locus tag: VSAK1_10293 Name: cusA Funciton: Cation efflux system protein CusA, transmembrane protein Locus tag: VSAK1_10288 Name: cusF Funciton: putative blue copper protein
	VSAK1_10308	VCA0262	Conserved hypothetical protein
	VSAK1_10303	cusC	Heavy metal RND efflux outer membrane protein, CzcC family
	VSAK1_10298	cusB	Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
	VSAK1_10293	cusA	Cation efflux system protein CusA, transmembrane protein
	VSAK1_10288	cusF	putative blue copper protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD