Regulon of CueR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VC0974
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 5.3 Sequence: ACCTTACCTTAAGGTTAAGGT Locus tag: VC2215 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: VC2216 Name: copG Funciton: Predicted metal-binding protein
	VC2215	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	VC2216	copG	Predicted metal-binding protein
Position: -57 Score: 4.5 Sequence: ACCTTCCCCTAGGGTAAAACT Locus tag: VCA0262 Name: VCA0262 Funciton: Conserved hypothetical protein
	VCA0262	VCA0262	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD