Regulog MntR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | ||
| Rhizobium sp. NGR234 | 3 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium etli CFN 42 | ||
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Mesorhizobium sp. BNC1 | 4 | 2 |
| Mesorhizobium loti MAFF303099 | 2 | 2 |
| Brucella melitensis 16M | ||
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | 2 | 2 |
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| mntR |
|
*
Rhizobium sp. NGR234 Site: position = -141 score = 6.2332 sequence = AATATAGCAAGTGCTATAAT Site: position = -61 score = 5.8004 sequence = AAAATAGCCTTAGCTATATT Gene: NGR_b14390: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -46 score = 5.05211 sequence = TCCATAGCCGAGGCTATAAT Site: position = -109 score = 5.82851 sequence = ATTATAGCAAATGCTATTTC Gene: Meso_4423: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Mesorhizobium loti MAFF303099 Site: position = -55 score = 5.19417 sequence = ATCAGAGCCCGTGCTATAAA Gene: mll2499: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
|
|
|
*
Bradyrhizobium sp. BTAi1 Site: position = -127 score = 5.44598 sequence = GATATAGCTTCTGCTACATT Gene: BBta_1555: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
|
|
Manganese homeostasis transcriptional regulator MntR, DtxR family |
| CRON 2. | ||||||||||||||||
| mntH |
|
|
Gene: RL0940: Manganese transporter, NRAMP family |
Gene: RHE_CH00878: Manganese transporter, NRAMP family |
Gene: Atu1736: Manganese transporter, NRAMP family |
Gene: Meso_4120: Manganese transporter, NRAMP family |
*
Mesorhizobium loti MAFF303099 Site: position = -195 score = 5.19417 sequence = TTTATAGCACGGGCTCTGAT Gene: mlr2501: Manganese transporter, NRAMP family |
Gene: BMEI0569: Manganese transporter, NRAMP family |
|
Gene: RPA2706: Manganese transporter, NRAMP family |
Gene: bll5044: Manganese transporter, NRAMP family |
*2
Bradyrhizobium sp. BTAi1 Site: position = -92 score = 5.44598 sequence = AATGTAGCAGAAGCTATATC Gene: BBta_1556: Manganese transporter, NRAMP family Gene: BBta_4658: Manganese transporter, NRAMP family |
Gene: Nwi_1912: Manganese transporter, NRAMP family |
Gene: AZC_3295: Manganese transporter, NRAMP family |
|
Manganese transporter, NRAMP family |
| CRON 3. | ||||||||||||||||
| COG2132 |
|
*
Rhizobium sp. NGR234 Site: position = -153 score = 5.8004 sequence = AATATAGCTAAGGCTATTTT Site: position = -73 score = 6.2332 sequence = ATTATAGCACTTGCTATATT Gene: NGR_b14380: Putative metal oxidase |
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -73 score = 5.82851 sequence = GAAATAGCATTTGCTATAAT Site: position = -136 score = 5.05211 sequence = ATTATAGCCTCGGCTATGGA Gene: Meso_4422: Putative metal oxidase |
|
|
|
|
|
|
|
|
Gene: Xaut_3971: Putative metal oxidase |
Putative metal oxidase |
| COG0428 |
|
Gene: NGR_b14370: Putative metal cation transporter |
|
|
|
Gene: Meso_4421: Putative metal cation transporter |
|
|
|
|
|
|
|
|
Gene: Xaut_3970: Putative metal cation transporter |
Putative metal cation transporter |
| cycX |
|
|
|
|
|
Gene: Meso_4420: Cytochrome c556 |
|
|
|
|
|
|
|
|
|
Cytochrome c556 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |