Regulon of MntR in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_4423
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 5.8 Sequence: ATTATAGCAAATGCTATTTC Position: -46 Score: 5.1 Sequence: TCCATAGCCGAGGCTATAAT Locus tag: Meso_4423 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	Meso_4423	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -136 Score: 5.1 Sequence: ATTATAGCCTCGGCTATGGA Position: -73 Score: 5.8 Sequence: GAAATAGCATTTGCTATAAT Locus tag: Meso_4422 Name: COG2132 Funciton: Putative metal oxidase Locus tag: Meso_4421 Name: COG0428 Funciton: Putative metal cation transporter Locus tag: Meso_4420 Name: cycX Funciton: Cytochrome c556
	Meso_4422	COG2132	Putative metal oxidase
	Meso_4421	COG0428	Putative metal cation transporter
	Meso_4420	cycX	Cytochrome c556

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD