Regulon of MntR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b14390
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -141 Score: 6.2 Sequence: AATATAGCAAGTGCTATAAT Position: -61 Score: 5.8 Sequence: AAAATAGCCTTAGCTATATT Locus tag: NGR_b14390 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	NGR_b14390	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -153 Score: 5.8 Sequence: AATATAGCTAAGGCTATTTT Position: -73 Score: 6.2 Sequence: ATTATAGCACTTGCTATATT Locus tag: NGR_b14380 Name: COG2132 Funciton: Putative metal oxidase Locus tag: NGR_b14370 Name: COG0428 Funciton: Putative metal cation transporter
	NGR_b14380	COG2132	Putative metal oxidase
	NGR_b14370	COG0428	Putative metal cation transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD