Regulog GntR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 9 | 3 |
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 | 3 | 3 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 5 | 3 |
| Aeromonas salmonicida subsp. salmonicida A449 | 5 | 3 |
| Tolumonas auensis DSM 9187 | 4 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| gntX |
*
Psychromonas ingrahamii 37 Site: position = -98 score = 5.99049 sequence = GTAAGTTACCGGTAACATTC Site: position = -76 score = 5.19872 sequence = ATCAGTTACCGGTAACCTAT Gene: Ping_2933: Predicted gluconate TRAP family transporter, DctP subunit |
|
*
Moritella sp. PE36 Site: position = -67 score = 5.89616 sequence = AATAGTTACCGGTAACATAA Gene: PE36_03014: Predicted gluconate TRAP family transporter, DctP subunit |
|
|
|
Predicted gluconate TRAP family transporter, DctP subunit |
| gntY |
Gene: Ping_2934: Predicted gluconate TRAP family transporter, DctQ subunit |
|
Gene: PE36_03009: Predicted gluconate TRAP family transporter, DctQ subunit |
|
|
|
Predicted gluconate TRAP family transporter, DctQ subunit |
| gntZ |
Gene: Ping_2935: Predicted gluconate TRAP family transporter, DctM subunit |
|
Gene: PE36_03004: Predicted gluconate TRAP family transporter, DctM subunit |
|
|
|
Predicted gluconate TRAP family transporter, DctM subunit |
| gntK2 |
Gene: Ping_2936: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
|
|
|
Thermoresistant gluconokinase (EC 2.7.1.12) |
| gnd |
Gene: Ping_2937: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44) |
|
*
Moritella sp. PE36 Site: position = -109 score = 4.69736 sequence = TAACGATAGCGTTAACATTG Gene: PE36_03034: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44) |
|
|
|
6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44) |
| CRON 2. | |||||||
| gntR |
*
Psychromonas ingrahamii 37 Site: position = -21 score = 6.08613 sequence = TTATGTTACAGGTAACATTT Gene: Ping_2929: Gluconate utilization transcriptional regulator GntR, LacI family |
|
Gene: PE36_03029: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -35 score = 5.79623 sequence = TAATGTTACGTGTAACATTT Gene: AHA_0290: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -35 score = 5.65215 sequence = TAATGTTACGTGTAACATTC Gene: ASA_4107: Gluconate utilization transcriptional regulator GntR, LacI family |
Gene: Tola_0775: Gluconate utilization transcriptional regulator GntR, LacI family |
Gluconate utilization transcriptional regulator GntR, LacI family |
| CRON 3. | |||||||
| gntT |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -190 score = 6.36571 sequence = GCACGTTACCGGTAACATGT Site: position = -176 score = 6.15468 sequence = ACATGTTACCGGTAACAACA Gene: AHA_0286: High-affinity H+/gluconate symporter |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -190 score = 5.89335 sequence = GCACGTTACCGGCAACATGT Site: position = -176 score = 6.15468 sequence = ACATGTTACCGGTAACAACA Gene: ASA_4111: High-affinity H+/gluconate symporter |
*
Tolumonas auensis DSM 9187 Site: position = -176 score = 6.39577 sequence = TCATGTTACCGGTAACAAGT Site: position = -190 score = 6.16627 sequence = GCATGTTACCGGTATCATGT Gene: Tola_0779: High-affinity H+/gluconate symporter |
High-affinity H+/gluconate symporter |
| CRON 4. | |||||||
| gntK |
*
Psychromonas ingrahamii 37 Site: position = -64 score = 5.60563 sequence = ATATGTTACCCGTAACTTAG Site: position = -78 score = 5.02426 sequence = TCAAGTTACGGCTAATATGT Gene: Ping_2932: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
*
Moritella sp. PE36 Site: position = -83 score = 5.15013 sequence = CTGTGTTAACGGTAACATTG Gene: PE36_03024: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -89 score = 6.15468 sequence = TGTTGTTACCGGTAACATGT Site: position = -75 score = 6.36571 sequence = ACATGTTACCGGTAACGTGC Gene: AHA_0287: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -89 score = 6.15468 sequence = TGTTGTTACCGGTAACATGT Site: position = -75 score = 5.89335 sequence = ACATGTTGCCGGTAACGTGC Gene: ASA_4110: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Tolumonas auensis DSM 9187 Site: position = -76 score = 6.16627 sequence = ACATGATACCGGTAACATGC Site: position = -90 score = 6.39577 sequence = ACTTGTTACCGGTAACATGA Gene: Tola_0778: Thermoresistant gluconokinase (EC 2.7.1.12) |
Thermoresistant gluconokinase (EC 2.7.1.12) |
| edd |
Gene: Ping_2931: Phosphogluconate dehydratase (EC 4.2.1.12) |
|
|
Gene: AHA_0288: Phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: ASA_4109: Phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Tola_0777: Phosphogluconate dehydratase (EC 4.2.1.12) |
Phosphogluconate dehydratase (EC 4.2.1.12) |
| eda |
Gene: Ping_2930: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
|
|
Gene: AHA_0289: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: ASA_4108: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Tola_0776: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |