Regulon of GntR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_03029
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5.2 Sequence: CTGTGTTAACGGTAACATTG Locus tag: PE36_03024 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	PE36_03024	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
Position: -109 Score: 4.7 Sequence: TAACGATAGCGTTAACATTG Locus tag: PE36_03034 Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
	PE36_03034	gnd	6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
Position: -67 Score: 5.9 Sequence: AATAGTTACCGGTAACATAA Locus tag: PE36_03014 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
	PE36_03014	gntX	Predicted gluconate TRAP family transporter, DctP subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD