Regulon of GntR in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_2929
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 5 Sequence: TCAAGTTACGGCTAATATGT Position: -64 Score: 5.6 Sequence: ATATGTTACCCGTAACTTAG Locus tag: Ping_2932 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Ping_2931 Name: edd Funciton: Phosphogluconate dehydratase (EC 4.2.1.12) Locus tag: Ping_2930 Name: eda Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
	Ping_2932	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	Ping_2931	edd	Phosphogluconate dehydratase (EC 4.2.1.12)
	Ping_2930	eda	2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
Position: -98 Score: 6 Sequence: GTAAGTTACCGGTAACATTC Position: -76 Score: 5.2 Sequence: ATCAGTTACCGGTAACCTAT Locus tag: Ping_2933 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: Ping_2934 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Ping_2935 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Ping_2936 Name: gntK2 Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Ping_2937 Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
	Ping_2933	gntX	Predicted gluconate TRAP family transporter, DctP subunit
	Ping_2934	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	Ping_2935	gntZ	Predicted gluconate TRAP family transporter, DctM subunit
	Ping_2936	gntK2	Thermoresistant gluconokinase (EC 2.7.1.12)
	Ping_2937	gnd	6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
Position: -21 Score: 6.1 Sequence: TTATGTTACAGGTAACATTT Locus tag: Ping_2929 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Ping_2929	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD