Regulog Caur_1157 - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus sp. Y-400-fl | 7 | 1 |
| Chloroflexus aggregans DSM 9485 | 7 | 1 |
| Herpetosiphon aurantiacus ATCC 23779 | 10 | 3 |
| Roseiflexus sp. RS-1 | ||
| Roseiflexus castenholzii DSM 13941 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| bglA |
|
Gene: Cagg_3435: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B) |
*
Herpetosiphon aurantiacus ATCC 23779 Site: position = -207 score = 5.69641 sequence = GCTTGGGAGCGATCTCATTC Site: position = -131 score = 6.03787 sequence = CATTGGGAGCGGTCTCAATG Gene: Haur_0296: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B) |
|
|
Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B) |
| Haur_0295 |
|
|
Gene: Haur_0295: Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A) |
|
|
Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A) |
| Haur_0293 |
|
|
2
Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0293: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2) Gene: Haur_0294: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2) |
|
|
Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2) |
| CRON 2. | ||||||
| Haur_1418 |
|
|
*
Herpetosiphon aurantiacus ATCC 23779 Site: position = -41 score = 5.21538 sequence = TATTGAGACCGATTCCAATG Gene: Haur_1418: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91) |
|
|
Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91) |
| CRON 3. | ||||||
| Caur_1157 |
*
Chloroflexus sp. Y-400-fl Site: position = -117 score = 5.57077 sequence = GACTGGAAGCGCTTTCACGG Gene: Chy400_1181: Predicted transcriptional regulator for beta-glucoside utilization, LacI family |
*
Chloroflexus aggregans DSM 9485 Site: position = -119 score = 5.57077 sequence = CCCTGGAAGCGCTTTCACGG Gene: Cagg_1685: Predicted transcriptional regulator for beta-glucoside utilization, LacI family |
*
Herpetosiphon aurantiacus ATCC 23779 Site: position = -347 score = 6.03787 sequence = CATTGAGACCGCTCCCAATG Site: position = -271 score = 5.69641 sequence = GAATGAGATCGCTCCCAAGC Gene: Haur_0297: Predicted transcriptional regulator for beta-glucoside utilization, LacI family |
|
|
Predicted transcriptional regulator for beta-glucoside utilization, LacI family |
| Chy400_1180 |
Gene: Chy400_1180: extracellular solute-binding protein family 1 |
Gene: Cagg_1686: extracellular solute-binding protein family 1 |
|
|
|
extracellular solute-binding protein family 1 |
| Chy400_1179 |
Gene: Chy400_1179: binding-protein-dependent transport systems inner membrane component |
Gene: Cagg_1687: binding-protein-dependent transport systems inner membrane component |
|
|
|
binding-protein-dependent transport systems inner membrane component |
| Chy400_1178 |
Gene: Chy400_1178: binding-protein-dependent transport systems inner membrane component |
Gene: Cagg_1688: binding-protein-dependent transport systems inner membrane component |
|
|
|
binding-protein-dependent transport systems inner membrane component |
| Chy400_1177 |
Gene: Chy400_1177: glycoside hydrolase family 3 domain protein |
Gene: Cagg_1689: glycoside hydrolase family 3 domain protein |
|
|
|
glycoside hydrolase family 3 domain protein |
| Chy400_1176 |
Gene: Chy400_1176: glycoside hydrolase family 16 |
Gene: Cagg_1690: glycoside hydrolase family 16 |
|
|
|
glycoside hydrolase family 16 |
| bglB |
Gene: Chy400_1175: Beta-glucosidase (EC 3.2.1.21) |
Gene: Cagg_1691: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
Beta-glucosidase (EC 3.2.1.21) |
| Haur_0298 |
|
|
Gene: Haur_0298: Sugar ABC transport system, sugar-binding protein |
|
|
Sugar ABC transport system, sugar-binding protein |
| Haur_0299 |
|
|
Gene: Haur_0299: Sugar ABC transporter permease |
|
|
Sugar ABC transporter permease |
| Haur_0300 |
|
|
Gene: Haur_0300: binding-protein-dependent transport systems inner membrane component |
|
|
binding-protein-dependent transport systems inner membrane component |
| Haur_0301 |
|
|
Gene: Haur_0301: hypothetical protein |
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |