Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus sp. Y-400-fl	7	1
Chloroflexus aggregans DSM 9485	7	1
Herpetosiphon aurantiacus ATCC 23779	10	3
Roseiflexus sp. RS-1
Roseiflexus castenholzii DSM 13941

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
bglA	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485 Gene: Cagg_3435: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -207 score = 5.69641 sequence = GCTTGGGAGCGATCTCATTC Site: position = -131 score = 6.03787 sequence = CATTGGGAGCGGTCTCAATG Gene: Haur_0296: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)
Haur_0295	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0295: Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A)	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A)
Haur_0293	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	2 Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0293: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2) Gene: Haur_0294: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
CRON 2.
Haur_1418	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -41 score = 5.21538 sequence = TATTGAGACCGATTCCAATG Gene: Haur_1418: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
CRON 3.
Caur_1157	* Chloroflexus sp. Y-400-fl Site: position = -117 score = 5.57077 sequence = GACTGGAAGCGCTTTCACGG Gene: Chy400_1181: Predicted transcriptional regulator for beta-glucoside utilization, LacI family	* Chloroflexus aggregans DSM 9485 Site: position = -119 score = 5.57077 sequence = CCCTGGAAGCGCTTTCACGG Gene: Cagg_1685: Predicted transcriptional regulator for beta-glucoside utilization, LacI family	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -347 score = 6.03787 sequence = CATTGAGACCGCTCCCAATG Site: position = -271 score = 5.69641 sequence = GAATGAGATCGCTCCCAAGC Gene: Haur_0297: Predicted transcriptional regulator for beta-glucoside utilization, LacI family	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Chy400_1180	Chloroflexus sp. Y-400-fl Gene: Chy400_1180: extracellular solute-binding protein family 1	Chloroflexus aggregans DSM 9485 Gene: Cagg_1686: extracellular solute-binding protein family 1	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	extracellular solute-binding protein family 1
Chy400_1179	Chloroflexus sp. Y-400-fl Gene: Chy400_1179: binding-protein-dependent transport systems inner membrane component	Chloroflexus aggregans DSM 9485 Gene: Cagg_1687: binding-protein-dependent transport systems inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	binding-protein-dependent transport systems inner membrane component
Chy400_1178	Chloroflexus sp. Y-400-fl Gene: Chy400_1178: binding-protein-dependent transport systems inner membrane component	Chloroflexus aggregans DSM 9485 Gene: Cagg_1688: binding-protein-dependent transport systems inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	binding-protein-dependent transport systems inner membrane component
Chy400_1177	Chloroflexus sp. Y-400-fl Gene: Chy400_1177: glycoside hydrolase family 3 domain protein	Chloroflexus aggregans DSM 9485 Gene: Cagg_1689: glycoside hydrolase family 3 domain protein	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	glycoside hydrolase family 3 domain protein
Chy400_1176	Chloroflexus sp. Y-400-fl Gene: Chy400_1176: glycoside hydrolase family 16	Chloroflexus aggregans DSM 9485 Gene: Cagg_1690: glycoside hydrolase family 16	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	glycoside hydrolase family 16
bglB	Chloroflexus sp. Y-400-fl Gene: Chy400_1175: Beta-glucosidase (EC 3.2.1.21)	Chloroflexus aggregans DSM 9485 Gene: Cagg_1691: Beta-glucosidase (EC 3.2.1.21)	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Beta-glucosidase (EC 3.2.1.21)
Haur_0298	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0298: Sugar ABC transport system, sugar-binding protein	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Sugar ABC transport system, sugar-binding protein
Haur_0299	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0299: Sugar ABC transporter permease	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	Sugar ABC transporter permease
Haur_0300	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0300: binding-protein-dependent transport systems inner membrane component	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	binding-protein-dependent transport systems inner membrane component
Haur_0301	Chloroflexus sp. Y-400-fl	Chloroflexus aggregans DSM 9485	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0301: hypothetical protein	Roseiflexus sp. RS-1	Roseiflexus castenholzii DSM 13941	hypothetical protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD