Regulon of Caur_1157 in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type:	Transcription factor
TF locus tag:	Haur_0297
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	Caur_1157 - Chloroflexia
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -207 Score: 5.7 Sequence: GCTTGGGAGCGATCTCATTC Position: -131 Score: 6 Sequence: CATTGGGAGCGGTCTCAATG Locus tag: Haur_0296 Name: bglA Funciton: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B) Locus tag: Haur_0295 Name: null Funciton: Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A) Locus tag: Haur_0294 Name: null Funciton: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2) Locus tag: Haur_0293 Name: null Funciton: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
	Haur_0296	bglA	Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)
	Haur_0295		Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A)
	Haur_0294		Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
	Haur_0293		Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
Position: -347 Score: 6 Sequence: CATTGAGACCGCTCCCAATG Position: -271 Score: 5.7 Sequence: GAATGAGATCGCTCCCAAGC Locus tag: Haur_0297 Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: Haur_0298 Name: Haur_0298 Funciton: Sugar ABC transport system, sugar-binding protein Locus tag: Haur_0299 Name: null Funciton: Sugar ABC transporter permease Locus tag: Haur_0300 Name: Haur_0300 Funciton: binding-protein-dependent transport systems inner membrane component Locus tag: Haur_0301 Name: null Funciton: hypothetical protein
	Haur_0297	Caur_1157	Predicted transcriptional regulator for beta-glucoside utilization, LacI family
	Haur_0298	Haur_0298	Sugar ABC transport system, sugar-binding protein
	Haur_0299		Sugar ABC transporter permease
	Haur_0300	Haur_0300	binding-protein-dependent transport systems inner membrane component
	Haur_0301		hypothetical protein
Position: -41 Score: 5.2 Sequence: TATTGAGACCGATTCCAATG Locus tag: Haur_1418 Name: null Funciton: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
	Haur_1418		Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD