Regulon of Caur_1157 in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_1181
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	Caur_1157 - Chloroflexia
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 5.6 Sequence: GACTGGAAGCGCTTTCACGG Locus tag: Chy400_1181 Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: Chy400_1180 Name: null Funciton: extracellular solute-binding protein family 1 Locus tag: Chy400_1179 Name: null Funciton: binding-protein-dependent transport systems inner membrane component Locus tag: Chy400_1178 Name: null Funciton: binding-protein-dependent transport systems inner membrane component Locus tag: Chy400_1177 Name: null Funciton: glycoside hydrolase family 3 domain protein Locus tag: Chy400_1176 Name: null Funciton: glycoside hydrolase family 16 Locus tag: Chy400_1175 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
	Chy400_1181	Caur_1157	Predicted transcriptional regulator for beta-glucoside utilization, LacI family
	Chy400_1180		extracellular solute-binding protein family 1
	Chy400_1179		binding-protein-dependent transport systems inner membrane component
	Chy400_1178		binding-protein-dependent transport systems inner membrane component
	Chy400_1177		glycoside hydrolase family 3 domain protein
	Chy400_1176		glycoside hydrolase family 16
	Chy400_1175	bglB	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD