Regulon of Caur_1157 in Chloroflexus sp. Y-400-fl
| Regulator type: | Transcription factor |
| TF locus tag: | Chy400_1181 |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Regulog: | Caur_1157 - Chloroflexia |
| Statistics of regulated genes: | |
| - Genes | 7 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -117
Score: 5.6 Sequence: GACTGGAAGCGCTTTCACGG
Locus tag: Chy400_1181
Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Chy400_1180
Name: null Funciton: extracellular solute-binding protein family 1
Locus tag: Chy400_1179
Name: null Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1178
Name: null Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1177
Name: null Funciton: glycoside hydrolase family 3 domain protein
Locus tag: Chy400_1176
Name: null Funciton: glycoside hydrolase family 16
Locus tag: Chy400_1175
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) |
|||
|
Caur_1157
|
Predicted transcriptional regulator for beta-glucoside utilization, LacI family
|
||
|
extracellular solute-binding protein family 1
|
|||
|
binding-protein-dependent transport systems inner membrane component
|
|||
|
binding-protein-dependent transport systems inner membrane component
|
|||
|
glycoside hydrolase family 3 domain protein
|
|||
|
glycoside hydrolase family 16
|
|||
|
bglB
|
Beta-glucosidase (EC 3.2.1.21)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |