Orthologous regulated operons containing Haur_1418 gene

Properties
Regulog:	Caur_1157 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Chloroflexi

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Herpetosiphon aurantiacus ATCC 23779
Position: -41 Score: 5.21538 Sequence: TATTGAGACCGATTCCAATG Locus tag: Haur_1418 Name: null Funciton: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
Haur_1418	-41	5.2	TATTGAGACCGATTCCAATG	Haur_1418

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --