Regulog YxeR - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - TetR
By pathway - Antibiotic resistance

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11	3	1
Lactococcus lactis subsp. lactis Il1403	3	1
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
yxeR	* Lactococcus lactis subsp. cremoris SK11 Site: position = -40 score = 6.87643 sequence = TAAATGACATAGTGTCATAAA Gene: LACR_0688: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactococcus lactis subsp. lactis Il1403 Site: position = -41 score = 7.05955 sequence = TAAATGACACAGTGTCATAAA Gene: L53789: Predicted antibiotic resistance transcriptional reguator, TetR family	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted antibiotic resistance transcriptional reguator, TetR family
yxeA	2 Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0687: Predicted antimicrobial peptide transporter, permease protein Gene: LACR_2585: Predicted antimicrobial peptide transporter, permease protein	2 Lactococcus lactis subsp. lactis Il1403 Gene: L52704: Predicted antimicrobial peptide transporter, permease protein Gene: L130944: Predicted antimicrobial peptide transporter, permease protein	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_0738: Predicted antimicrobial peptide transporter, permease protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0807: Predicted antimicrobial peptide transporter, permease protein	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy0772: Predicted antimicrobial peptide transporter, permease protein	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0682: Predicted antimicrobial peptide transporter, permease protein	Predicted antimicrobial peptide transporter, permease protein
yxeB	2 Lactococcus lactis subsp. cremoris SK11 Gene: LACR_2586: Predicted antimicrobial peptide transporter, ATP-binding protein Gene: LACR_0686: Predicted antimicrobial peptide transporter, ATP-binding protein	2 Lactococcus lactis subsp. lactis Il1403 Gene: L132038: Predicted antimicrobial peptide transporter, ATP-binding protein Gene: L52030: Predicted antimicrobial peptide transporter, ATP-binding protein	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_0739: Predicted antimicrobial peptide transporter, ATP-binding protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0808: Predicted antimicrobial peptide transporter, ATP-binding protein	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy0773: Predicted antimicrobial peptide transporter, ATP-binding protein	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0683: Predicted antimicrobial peptide transporter, ATP-binding protein	Predicted antimicrobial peptide transporter, ATP-binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YxeR - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --