Regulog YxeR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Antibiotic resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - TetR
- By pathway - Antibiotic resistance
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | 3 | 1 |
| Lactococcus lactis subsp. lactis Il1403 | 3 | 1 |
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| yxeR |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -40 score = 6.87643 sequence = TAAATGACATAGTGTCATAAA Gene: LACR_0688: Predicted antibiotic resistance transcriptional reguator, TetR family |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -41 score = 7.05955 sequence = TAAATGACACAGTGTCATAAA Gene: L53789: Predicted antibiotic resistance transcriptional reguator, TetR family |
|
|
|
|
|
|
|
|
|
|
|
|
|
Predicted antibiotic resistance transcriptional reguator, TetR family |
| yxeA |
2
Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0687: Predicted antimicrobial peptide transporter, permease protein Gene: LACR_2585: Predicted antimicrobial peptide transporter, permease protein |
2
Lactococcus lactis subsp. lactis Il1403 Gene: L52704: Predicted antimicrobial peptide transporter, permease protein Gene: L130944: Predicted antimicrobial peptide transporter, permease protein |
|
Gene: SDEG_0738: Predicted antimicrobial peptide transporter, permease protein |
Gene: Sez_0807: Predicted antimicrobial peptide transporter, permease protein |
|
|
|
|
|
Gene: SPy0772: Predicted antimicrobial peptide transporter, permease protein |
|
|
|
Gene: SUB0682: Predicted antimicrobial peptide transporter, permease protein |
Predicted antimicrobial peptide transporter, permease protein |
| yxeB |
2
Lactococcus lactis subsp. cremoris SK11 Gene: LACR_2586: Predicted antimicrobial peptide transporter, ATP-binding protein Gene: LACR_0686: Predicted antimicrobial peptide transporter, ATP-binding protein |
2
Lactococcus lactis subsp. lactis Il1403 Gene: L132038: Predicted antimicrobial peptide transporter, ATP-binding protein Gene: L52030: Predicted antimicrobial peptide transporter, ATP-binding protein |
|
Gene: SDEG_0739: Predicted antimicrobial peptide transporter, ATP-binding protein |
Gene: Sez_0808: Predicted antimicrobial peptide transporter, ATP-binding protein |
|
|
|
|
|
Gene: SPy0773: Predicted antimicrobial peptide transporter, ATP-binding protein |
|
|
|
Gene: SUB0683: Predicted antimicrobial peptide transporter, ATP-binding protein |
Predicted antimicrobial peptide transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |