Regulon of YxeR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type:	Transcription factor
TF locus tag:	L53789
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Regulog:	YxeR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - TetR
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 7.1 Sequence: TAAATGACACAGTGTCATAAA Locus tag: L53789 Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family Locus tag: L52704 Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein Locus tag: L52030 Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein
	L53789	yxeR	Predicted antibiotic resistance transcriptional reguator, TetR family
	L52704	yxeA	Predicted antimicrobial peptide transporter, permease protein
	L52030	yxeB	Predicted antimicrobial peptide transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD