Regulon of YxeR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:	LACR_0688
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Regulog:	YxeR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - TetR
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 6.9 Sequence: TAAATGACATAGTGTCATAAA Locus tag: LACR_0688 Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family Locus tag: LACR_0687 Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein Locus tag: LACR_0686 Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein
	LACR_0688	yxeR	Predicted antibiotic resistance transcriptional reguator, TetR family
	LACR_0687	yxeA	Predicted antimicrobial peptide transporter, permease protein
	LACR_0686	yxeB	Predicted antimicrobial peptide transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD