Regulog YxeR - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - TetR
By pathway - Antibiotic resistance

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM	3	1
Lactobacillus brevis ATCC 367	3	1
Lactobacillus casei ATCC 334	3	1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	3	1
Lactobacillus fermentum IFO 3956	3	1
Lactobacillus helveticus DPC 4571	3	1
Lactobacillus johnsonii NCC 533	3	1
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112	3	1
Lactobacillus rhamnosus GG	3	1
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1	3	1
Pediococcus pentosaceus ATCC 25745	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
yxeR	* Lactobacillus acidophilus NCFM Site: position = -81 score = 3.62285 sequence = TTATTGACAACTCGTCACAAT Gene: LBA1840: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactobacillus brevis ATCC 367 Site: position = -46 score = 5.08897 sequence = TAAGTGACGCCGTGTCACTTA Site: position = -90 score = 4.28818 sequence = AAGTTGACACGGTGTCACTCA Gene: LVIS_2199: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactobacillus casei ATCC 334 Site: position = -77 score = 4.16518 sequence = ATGTTGACACGGTGTCACTTT Site: position = -33 score = 4.68857 sequence = TTAGTGACACCGTGTCACCAC Gene: LSEI_0394: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -73 score = 3.11839 sequence = GTGTTGGAACGGTGTCACTTT Site: position = -29 score = 3.48738 sequence = AGGGTGACACGGTGTCACGGA Gene: LBUL_1914: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactobacillus fermentum IFO 3956 Site: position = -83 score = 3.76478 sequence = AAGTTGACACGGTGTCACCTC Site: position = -42 score = 4.16518 sequence = CGAGTGACACGGTGTCACTAT Gene: LAF_1826: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactobacillus helveticus DPC 4571 Site: position = -80 score = 4.49461 sequence = GTATTGACAATGCGTCACAAA Gene: lhv_1880: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactobacillus johnsonii NCC 533 Site: position = -31 score = 4.96597 sequence = AAAGTGACACAGTGTCACAAG Site: position = -75 score = 4.16518 sequence = ATGTTGACACGGTGTCACTTT Gene: LJ0539: Predicted antibiotic resistance transcriptional reguator, TetR family	Lactobacillus plantarum WCFS1	* Lactobacillus reuteri JCM 1112 Site: position = -38 score = 3.36439 sequence = ACGGTGACACGGTGTCACGAT Site: position = -83 score = 4.50545 sequence = TGATTGACATGGTGTCACTTT Gene: LAR_1741: Predicted antibiotic resistance transcriptional reguator, TetR family	* Lactobacillus rhamnosus GG Site: position = -122 score = 4.16518 sequence = AAGTTGACACCGTGTCACTAT Site: position = -78 score = 3.36439 sequence = ACGGTGACACGGTGTCACCAT Gene: LGG_00488: Predicted antibiotic resistance transcriptional reguator, TetR family	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	* Oenococcus oeni PSU-1 Site: position = -35 score = 4.90585 sequence = TTAGTGACGTGGTGTCACTTA Site: position = -72 score = 3.64179 sequence = AAATTGACGCCGTGTCACCAT Gene: OEOE_0733: Predicted antibiotic resistance transcriptional reguator, TetR family	* Pediococcus pentosaceus ATCC 25745 Site: position = -41 score = 5.21197 sequence = TTGTTGACACGGTGTCATTTT Site: position = -76 score = 4.56558 sequence = ATTTTGACACGGTGTCACTTT Gene: PEPE_0017: Predicted antibiotic resistance transcriptional reguator, TetR family	Predicted antibiotic resistance transcriptional reguator, TetR family
yxeA	Lactobacillus acidophilus NCFM Gene: LBA1839: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus brevis ATCC 367 Gene: LVIS_2198: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus casei ATCC 334 Gene: LSEI_0395: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1913: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus fermentum IFO 3956 Gene: LAF_1825: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus helveticus DPC 4571 Gene: lhv_1879: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus johnsonii NCC 533 Gene: LJ0540: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112 Gene: LAR_1740: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus rhamnosus GG Gene: LGG_00489: Predicted antimicrobial peptide transporter, permease protein	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1 Gene: OEOE_0734: Predicted antimicrobial peptide transporter, permease protein	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0018: Predicted antimicrobial peptide transporter, permease protein	Predicted antimicrobial peptide transporter, permease protein
yxeB	Lactobacillus acidophilus NCFM Gene: LBA1838: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus brevis ATCC 367 Gene: LVIS_2197: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus casei ATCC 334 Gene: LSEI_0396: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1912: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus fermentum IFO 3956 Gene: LAF_1824: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus helveticus DPC 4571 Gene: lhv_1878: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus johnsonii NCC 533 Gene: LJ0541: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112 Gene: LAR_1739: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus rhamnosus GG Gene: LGG_00490: Predicted antimicrobial peptide transporter, ATP-binding protein	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1 Gene: OEOE_0735: Predicted antimicrobial peptide transporter, ATP-binding protein	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0019: Predicted antimicrobial peptide transporter, ATP-binding protein	Predicted antimicrobial peptide transporter, ATP-binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YxeR - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --