Regulon of YxeR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_0017
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Regulog:	YxeR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - TetR
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 4.6 Sequence: ATTTTGACACGGTGTCACTTT Position: -41 Score: 5.2 Sequence: TTGTTGACACGGTGTCATTTT Locus tag: PEPE_0017 Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family Locus tag: PEPE_0018 Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein Locus tag: PEPE_0019 Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein
	PEPE_0017	yxeR	Predicted antibiotic resistance transcriptional reguator, TetR family
	PEPE_0018	yxeA	Predicted antimicrobial peptide transporter, permease protein
	PEPE_0019	yxeB	Predicted antimicrobial peptide transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD