Regulon of YxeR in Lactobacillus helveticus DPC 4571

Properties
Regulator type:	Transcription factor
TF locus tag:	lhv_1880
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:
Regulog:	YxeR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - TetR
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 4.5 Sequence: GTATTGACAATGCGTCACAAA Locus tag: lhv_1880 Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family Locus tag: lhv_1879 Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein Locus tag: lhv_1878 Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein
	lhv_1880	yxeR	Predicted antibiotic resistance transcriptional reguator, TetR family
	lhv_1879	yxeA	Predicted antimicrobial peptide transporter, permease protein
	lhv_1878	yxeB	Predicted antimicrobial peptide transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD