Regulog YtrA - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By pathway - Hypothetical ABC transporter
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 3 | 1 |
| Lactobacillus casei ATCC 334 | 1 | 1 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | 2 | 1 |
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 4 | 1 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | 3 | 1 |
| Lactobacillus sakei subsp. sakei 23K | 4 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 5 | 1 |
| Oenococcus oeni PSU-1 | 4 | 1 |
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| ytrA |
|
*
Lactobacillus brevis ATCC 367 Site: position = -60 score = 6.74141 sequence = GTGTACTAGGTATAATAGTACAG Gene: LVIS_0408: Predicted transcriptional regulator, GntR family |
*
Lactobacillus casei ATCC 334 Site: position = -46 score = 6.94443 sequence = GTGTACTACGTATAATAGTACAC Gene: LSEI_2244: Predicted transcriptional regulator, GntR family |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -50 score = 6.66981 sequence = GTGTACTAGAATAAATAGTACAG Gene: LBUL_1589: Predicted transcriptional regulator, GntR family |
|
|
|
*2
Lactobacillus plantarum WCFS1 Gene: lp_0325: Predicted transcriptional regulator, GntR family Site: position = -49 score = 6.25128 sequence = GTGTACTAGTTGTAGTAATACAC Gene: lp_1959: Predicted transcriptional regulator, GntR family |
|
*
Lactobacillus rhamnosus GG Site: position = -46 score = 6.6648 sequence = GTGTACTGCGTATAATAGTACAC Gene: LGG_02246: Predicted transcriptional regulator, GntR family |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -61 score = 6.78114 sequence = GTGTACTACGTATAATAGTACAG Gene: LSA1419: Predicted transcriptional regulator, GntR family |
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -123 score = 6.62508 sequence = GTGTACTGTGTATTATAGTACAC Gene: LEUM_0050: Predicted transcriptional regulator, GntR family |
Gene: OEOE_1803: Predicted transcriptional regulator, GntR family |
|
Predicted transcriptional regulator, GntR family |
| ytrB |
|
Gene: LVIS_0409: Predicted ABC transporter, ATP-binding protein |
|
Gene: LBUL_1588: Predicted ABC transporter, ATP-binding protein |
|
|
|
2
Lactobacillus plantarum WCFS1 Gene: lp_0326: Predicted ABC transporter, ATP-binding protein Gene: lp_1958: Predicted ABC transporter, ATP-binding protein |
|
Gene: LGG_02245: Predicted ABC transporter, ATP-binding protein |
2
Lactobacillus sakei subsp. sakei 23K Gene: LSA1418: Predicted ABC transporter, ATP-binding protein Gene: LSA1417: Predicted ABC transporter, ATP-binding protein |
|
2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0051: Predicted ABC transporter, ATP-binding protein Gene: LEUM_0053: Predicted ABC transporter, ATP-binding protein |
*2
Oenococcus oeni PSU-1 Gene: OEOE_1802: Predicted ABC transporter, ATP-binding protein Site: position = -45 score = 6.57625 sequence = CTGTACTAATTAATATAGTACAC Gene: OEOE_1805: Predicted ABC transporter, ATP-binding protein |
|
Predicted ABC transporter, ATP-binding protein |
| LEUM_0052 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: LEUM_0052: Hypothetical protein |
|
|
Hypothetical protein |
| OEOE_1804 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: LEUM_0054: Predicted ABC transporter, permease protein |
Gene: OEOE_1804: Predicted ABC transporter, permease protein |
|
Predicted ABC transporter, permease protein |
| lp_1957 |
|
|
|
|
|
|
|
Gene: lp_1957: ABC transporter, permease protein |
|
|
|
|
|
|
|
ABC transporter, permease protein |
| lp_1956 |
|
|
|
|
|
|
|
Gene: lp_1956: ABC transporter, permease protein |
|
|
|
|
|
|
|
ABC transporter, permease protein |
| lp_0327 |
|
Gene: LVIS_0410: Predicted ABC transporter, permease protein |
Gene: LSEI_2242: Predicted ABC transporter, permease protein |
|
|
|
|
Gene: lp_0327: Predicted ABC transporter, permease protein |
|
Gene: LGG_02244: Predicted ABC transporter, permease protein |
Gene: LSA1416: Predicted ABC transporter, permease protein |
|
|
|
|
Predicted ABC transporter, permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |