Regulog YtrA - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367	3	1
Lactobacillus casei ATCC 334	1	1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	2	1
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1	4	1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG	3	1
Lactobacillus sakei subsp. sakei 23K	4	1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	5	1
Oenococcus oeni PSU-1	4	1
Pediococcus pentosaceus ATCC 25745

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
ytrA	Lactobacillus acidophilus NCFM	* Lactobacillus brevis ATCC 367 Site: position = -60 score = 6.74141 sequence = GTGTACTAGGTATAATAGTACAG Gene: LVIS_0408: Predicted transcriptional regulator, GntR family	* Lactobacillus casei ATCC 334 Site: position = -46 score = 6.94443 sequence = GTGTACTACGTATAATAGTACAC Gene: LSEI_2244: Predicted transcriptional regulator, GntR family	* Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -50 score = 6.66981 sequence = GTGTACTAGAATAAATAGTACAG Gene: LBUL_1589: Predicted transcriptional regulator, GntR family	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	2 Lactobacillus plantarum WCFS1* Gene: lp_0325: Predicted transcriptional regulator, GntR family Site: position = -49 score = 6.25128 sequence = GTGTACTAGTTGTAGTAATACAC Gene: lp_1959: Predicted transcriptional regulator, GntR family	Lactobacillus reuteri JCM 1112	* Lactobacillus rhamnosus GG Site: position = -46 score = 6.6648 sequence = GTGTACTGCGTATAATAGTACAC Gene: LGG_02246: Predicted transcriptional regulator, GntR family	* Lactobacillus sakei subsp. sakei 23K Site: position = -61 score = 6.78114 sequence = GTGTACTACGTATAATAGTACAG Gene: LSA1419: Predicted transcriptional regulator, GntR family	Lactobacillus salivarius subsp. salivarius UCC118	* Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -123 score = 6.62508 sequence = GTGTACTGTGTATTATAGTACAC Gene: LEUM_0050: Predicted transcriptional regulator, GntR family	Oenococcus oeni PSU-1 Gene: OEOE_1803: Predicted transcriptional regulator, GntR family	Pediococcus pentosaceus ATCC 25745	Predicted transcriptional regulator, GntR family
ytrB	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0409: Predicted ABC transporter, ATP-binding protein	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1588: Predicted ABC transporter, ATP-binding protein	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	2 Lactobacillus plantarum WCFS1 Gene: lp_0326: Predicted ABC transporter, ATP-binding protein Gene: lp_1958: Predicted ABC transporter, ATP-binding protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_02245: Predicted ABC transporter, ATP-binding protein	2 Lactobacillus sakei subsp. sakei 23K Gene: LSA1418: Predicted ABC transporter, ATP-binding protein Gene: LSA1417: Predicted ABC transporter, ATP-binding protein	Lactobacillus salivarius subsp. salivarius UCC118	2 Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0051: Predicted ABC transporter, ATP-binding protein Gene: LEUM_0053: Predicted ABC transporter, ATP-binding protein	2 Oenococcus oeni PSU-1* Gene: OEOE_1802: Predicted ABC transporter, ATP-binding protein Site: position = -45 score = 6.57625 sequence = CTGTACTAATTAATATAGTACAC Gene: OEOE_1805: Predicted ABC transporter, ATP-binding protein	Pediococcus pentosaceus ATCC 25745	Predicted ABC transporter, ATP-binding protein
LEUM_0052	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0052: Hypothetical protein	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Hypothetical protein
OEOE_1804	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0054: Predicted ABC transporter, permease protein	Oenococcus oeni PSU-1 Gene: OEOE_1804: Predicted ABC transporter, permease protein	Pediococcus pentosaceus ATCC 25745	Predicted ABC transporter, permease protein
lp_1957	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_1957: ABC transporter, permease protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	ABC transporter, permease protein
lp_1956	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_1956: ABC transporter, permease protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	ABC transporter, permease protein
lp_0327	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0410: Predicted ABC transporter, permease protein	Lactobacillus casei ATCC 334 Gene: LSEI_2242: Predicted ABC transporter, permease protein	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_0327: Predicted ABC transporter, permease protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_02244: Predicted ABC transporter, permease protein	Lactobacillus sakei subsp. sakei 23K Gene: LSA1416: Predicted ABC transporter, permease protein	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Predicted ABC transporter, permease protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YtrA - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --